EMAIL THIS PAGE TO A FRIEND

C12orf66

chromosome 12 open reading frame 66

34 Gene Product Result for
Species: Human C12orf66(144577)
UniProtKB ID: Q96MD2, C9JX54, Q8IYA0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152440 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042891 MISSION® esiRNA esiRNA human C12orf66 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152440 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094039 predicted 1187
2 SASI_Hs01_00094040 predicted 1173
3 SASI_Hs01_00094041 predicted 1458
4 SASI_Hs01_00094042 predicted 1444
5 SASI_Hs01_00094043 predicted 328
6 SASI_Hs01_00094045 predicted 1221
7 SASI_Hs01_00094046 predicted 520
8 SASI_Hs01_00094047 predicted 1387
9 SASI_Hs01_00094048 predicted 506
10 SASI_Hs02_00366190 predicted 1010
11 SASI_Hs01_00094044 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152440
VALIDATED
C12orf66 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 66
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1462s21c1
Sequence:CCGGGTGGTCTGTGAATAGAGTTTACTCGAGTAAACTCTATTCACAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152440.4-508s21c1
Sequence:CCGGGCACACAGAAGTTCATCAATGCTCGAGCATTGATGAACTTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1537s21c1
Sequence:CCGGCACACTTTATAAGCAATTAAGCTCGAGCTTAATTGCTTATAAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1783s21c1
Sequence:CCGGAGAGTAATAGGGATGAGATATCTCGAGATATCTCATCCCTATTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-863s1c1
Sequence:CCGGCGACAAACGACTGCTTCAGAACTCGAGTTCTGAAGCAGTCGTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-418s1c1
Sequence:CCGGCTTCTTTGTTCAGGCTCGGATCTCGAGATCCGAGCCTGAACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152440.2-1189s1c1
Sequence:CCGGCAAAGTTCAGAGTACCTACTTCTCGAGAAGTAGGTACTCTGAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152440.2-821s1c1
Sequence:CCGGCTTCTTGCCAAGTTTAGCTTTCTCGAGAAAGCTAAACTTGGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152440.2-1172s1c1
Sequence:CCGGGTCCACTTCTATGATGACAAACTCGAGTTTGTCATCATAGAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-436s1c1
Sequence:CCGGGATGGAGATAGCAGACTTCTACTCGAGTAGAAGTCTGCTATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_152440.2-1220s1c1
Sequence:CCGGCCGGAACCTCACTTTACCATTCTCGAGAATGGTAAAGTGAGGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152440
VALIDATED
C12orf66 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 66
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1462s21c1
Sequence:CCGGGTGGTCTGTGAATAGAGTTTACTCGAGTAAACTCTATTCACAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152440.4-508s21c1
Sequence:CCGGGCACACAGAAGTTCATCAATGCTCGAGCATTGATGAACTTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1537s21c1
Sequence:CCGGCACACTTTATAAGCAATTAAGCTCGAGCTTAATTGCTTATAAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1783s21c1
Sequence:CCGGAGAGTAATAGGGATGAGATATCTCGAGATATCTCATCCCTATTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-863s1c1
Sequence:CCGGCGACAAACGACTGCTTCAGAACTCGAGTTCTGAAGCAGTCGTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-418s1c1
Sequence:CCGGCTTCTTTGTTCAGGCTCGGATCTCGAGATCCGAGCCTGAACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152440.2-1189s1c1
Sequence:CCGGCAAAGTTCAGAGTACCTACTTCTCGAGAAGTAGGTACTCTGAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152440.2-821s1c1
Sequence:CCGGCTTCTTGCCAAGTTTAGCTTTCTCGAGAAAGCTAAACTTGGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152440.2-1172s1c1
Sequence:CCGGGTCCACTTCTATGATGACAAACTCGAGTTTGTCATCATAGAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-436s1c1
Sequence:CCGGGATGGAGATAGCAGACTTCTACTCGAGTAGAAGTCTGCTATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_152440.2-1220s1c1
Sequence:CCGGCCGGAACCTCACTTTACCATTCTCGAGAATGGTAAAGTGAGGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152440
VALIDATED
C12orf66 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 66
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1462s21c1
Sequence:CCGGGTGGTCTGTGAATAGAGTTTACTCGAGTAAACTCTATTCACAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152440.4-508s21c1
Sequence:CCGGGCACACAGAAGTTCATCAATGCTCGAGCATTGATGAACTTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1537s21c1
Sequence:CCGGCACACTTTATAAGCAATTAAGCTCGAGCTTAATTGCTTATAAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152440.4-1783s21c1
Sequence:CCGGAGAGTAATAGGGATGAGATATCTCGAGATATCTCATCCCTATTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-863s1c1
Sequence:CCGGCGACAAACGACTGCTTCAGAACTCGAGTTCTGAAGCAGTCGTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-418s1c1
Sequence:CCGGCTTCTTTGTTCAGGCTCGGATCTCGAGATCCGAGCCTGAACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152440.2-1189s1c1
Sequence:CCGGCAAAGTTCAGAGTACCTACTTCTCGAGAAGTAGGTACTCTGAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152440.2-821s1c1
Sequence:CCGGCTTCTTGCCAAGTTTAGCTTTCTCGAGAAAGCTAAACTTGGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152440.2-1172s1c1
Sequence:CCGGGTCCACTTCTATGATGACAAACTCGAGTTTGTCATCATAGAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152440.2-436s1c1
Sequence:CCGGGATGGAGATAGCAGACTTCTACTCGAGTAGAAGTCTGCTATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_152440.2-1220s1c1
Sequence:CCGGCCGGAACCTCACTTTACCATTCTCGAGAATGGTAAAGTGAGGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks