EMAIL THIS PAGE TO A FRIEND

C12orf68

chromosome 12 open reading frame 68

Species: Human C12orf68(387856)
UniProtKB ID: Q52MB2, Q96MK5, Q96N39
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013635 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150381 MISSION® esiRNA esiRNA human C12orf68 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013635 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196458 predicted 1451
2 SASI_Hs01_00196459 predicted 1259
3 SASI_Hs01_00196460 predicted 1282
4 SASI_Hs01_00196462 predicted 1395
5 SASI_Hs02_00306406 predicted 1449
6 SASI_Hs01_00196464 predicted 1232
7 SASI_Hs01_00196465 predicted 1215
8 SASI_Hs02_00306407 predicted 1467
9 SASI_Hs01_00196467 predicted 1273
10 SASI_Hs02_00306408 predicted 1444
11 SASI_Hs01_00196461 predicted 1274
12 SASI_Hs01_00196463 predicted 1470
13 SASI_Hs01_00196466 predicted 1462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013635
C12orf68 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 68
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-2112s1c1
Sequence:CCGGCCAAGCTATCAATGGCGCTTTCTCGAGAAAGCGCCATTGATAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1933s1c1
Sequence:CCGGCTGCTTAACTTCAGTTCCTTTCTCGAGAAAGGAACTGAAGTTAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1403s1c1
Sequence:CCGGCCCGTGAATTGTGTAAATAAACTCGAGTTTATTTACACAATTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1400s1c1
Sequence:CCGGGAACCCGTGAATTGTGTAAATCTCGAGATTTACACAATTCACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1541s1c1
Sequence:CCGGCCTTCTGCTGAAATCCAAGATCTCGAGATCTTGGATTTCAGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1932s1c1
Sequence:CCGGCCTGCTTAACTTCAGTTCCTTCTCGAGAAGGAACTGAAGTTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013635.2-631s1c1
Sequence:CCGGGAACTGATGGAGCACCTGAAACTCGAGTTTCAGGTGCTCCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013635.3-1287s21c1
Sequence:CCGGGACTTTGGGAGCATCGAGAATCTCGAGATTCTCGATGCTCCCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013635.3-1500s21c1
Sequence:CCGGGGCAAATAATCTCTAACAATTCTCGAGAATTGTTAGAGATTATTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013635.3-1086s21c1
Sequence:CCGGCATTACCCTGCTGCAACTGGACTCGAGTCCAGTTGCAGCAGGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013635
C12orf68 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 68
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-2112s1c1
Sequence:CCGGCCAAGCTATCAATGGCGCTTTCTCGAGAAAGCGCCATTGATAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1933s1c1
Sequence:CCGGCTGCTTAACTTCAGTTCCTTTCTCGAGAAAGGAACTGAAGTTAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1403s1c1
Sequence:CCGGCCCGTGAATTGTGTAAATAAACTCGAGTTTATTTACACAATTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1400s1c1
Sequence:CCGGGAACCCGTGAATTGTGTAAATCTCGAGATTTACACAATTCACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1541s1c1
Sequence:CCGGCCTTCTGCTGAAATCCAAGATCTCGAGATCTTGGATTTCAGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1932s1c1
Sequence:CCGGCCTGCTTAACTTCAGTTCCTTCTCGAGAAGGAACTGAAGTTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013635.2-631s1c1
Sequence:CCGGGAACTGATGGAGCACCTGAAACTCGAGTTTCAGGTGCTCCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013635.3-1287s21c1
Sequence:CCGGGACTTTGGGAGCATCGAGAATCTCGAGATTCTCGATGCTCCCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013635.3-1500s21c1
Sequence:CCGGGGCAAATAATCTCTAACAATTCTCGAGAATTGTTAGAGATTATTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013635.3-1086s21c1
Sequence:CCGGCATTACCCTGCTGCAACTGGACTCGAGTCCAGTTGCAGCAGGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013635
C12orf68 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 68
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-2112s1c1
Sequence:CCGGCCAAGCTATCAATGGCGCTTTCTCGAGAAAGCGCCATTGATAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1933s1c1
Sequence:CCGGCTGCTTAACTTCAGTTCCTTTCTCGAGAAAGGAACTGAAGTTAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1403s1c1
Sequence:CCGGCCCGTGAATTGTGTAAATAAACTCGAGTTTATTTACACAATTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1400s1c1
Sequence:CCGGGAACCCGTGAATTGTGTAAATCTCGAGATTTACACAATTCACGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1541s1c1
Sequence:CCGGCCTTCTGCTGAAATCCAAGATCTCGAGATCTTGGATTTCAGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013635.2-1932s1c1
Sequence:CCGGCCTGCTTAACTTCAGTTCCTTCTCGAGAAGGAACTGAAGTTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013635.2-631s1c1
Sequence:CCGGGAACTGATGGAGCACCTGAAACTCGAGTTTCAGGTGCTCCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013635.3-1287s21c1
Sequence:CCGGGACTTTGGGAGCATCGAGAATCTCGAGATTCTCGATGCTCCCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013635.3-1500s21c1
Sequence:CCGGGGCAAATAATCTCTAACAATTCTCGAGAATTGTTAGAGATTATTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013635.3-1086s21c1
Sequence:CCGGCATTACCCTGCTGCAACTGGACTCGAGTCCAGTTGCAGCAGGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks