EMAIL THIS PAGE TO A FRIEND

C12orf71

chromosome 12 open reading frame 71

15 Gene Product Result for
Species: Human C12orf71(728858)
UniProtKB ID: A8MTZ7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080406 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314538 predicted 321
2 SASI_Hs02_00314539 predicted 414
3 SASI_Hs02_00314540 predicted 361
4 SASI_Hs02_00314541 predicted 241
5 SASI_Hs02_00314542 predicted 317
6 SASI_Hs02_00314543 predicted 382
7 SASI_Hs02_00314544 predicted 466
8 SASI_Hs02_00314545 predicted 260
9 SASI_Hs02_00314546 predicted 410
10 SASI_Hs02_00314547 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080406
C12orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 71
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-442s21c1
Sequence:CCGGGTGCAAGAGTTTCAGATATTTCTCGAGAAATATCTGAAACTCTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-318s21c1
Sequence:CCGGCGTGGACATTGGCTCCGATAACTCGAGTTATCGGAGCCAATGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-103s21c1
Sequence:CCGGAGCCTCTCTGTGGGCTATTTCCTCGAGGAAATAGCCCACAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-474s21c1
Sequence:CCGGGAAAGATGATGACGCTGTATTCTCGAGAATACAGCGTCATCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-74s21c1
Sequence:CCGGACGACAGCTCCAAATCCAATTCTCGAGAATTGGATTTGGAGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080406
C12orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 71
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-442s21c1
Sequence:CCGGGTGCAAGAGTTTCAGATATTTCTCGAGAAATATCTGAAACTCTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-318s21c1
Sequence:CCGGCGTGGACATTGGCTCCGATAACTCGAGTTATCGGAGCCAATGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-103s21c1
Sequence:CCGGAGCCTCTCTGTGGGCTATTTCCTCGAGGAAATAGCCCACAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-474s21c1
Sequence:CCGGGAAAGATGATGACGCTGTATTCTCGAGAATACAGCGTCATCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-74s21c1
Sequence:CCGGACGACAGCTCCAAATCCAATTCTCGAGAATTGGATTTGGAGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080406
C12orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 71
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-442s21c1
Sequence:CCGGGTGCAAGAGTTTCAGATATTTCTCGAGAAATATCTGAAACTCTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-318s21c1
Sequence:CCGGCGTGGACATTGGCTCCGATAACTCGAGTTATCGGAGCCAATGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-103s21c1
Sequence:CCGGAGCCTCTCTGTGGGCTATTTCCTCGAGGAAATAGCCCACAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-474s21c1
Sequence:CCGGGAAAGATGATGACGCTGTATTCTCGAGAATACAGCGTCATCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080406.1-74s21c1
Sequence:CCGGACGACAGCTCCAAATCCAATTCTCGAGAATTGGATTTGGAGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks