EMAIL THIS PAGE TO A FRIEND

C12orf73

chromosome 12 open reading frame 73

35 Gene Product Result for
Species: Human C12orf73(728568)
UniProtKB ID: Q69YU5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038883 Anti-C12orf73 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001135570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135570 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104381 MISSION® esiRNA esiRNA human C12orf73 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_042054 Rosetta Predictions human pricing
XR_042055 Rosetta Predictions human pricing
XR_042056 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532677 predicted 675
2 SASI_Hs02_00532678 predicted 782
3 SASI_Hs02_00532679 predicted 744
4 SASI_Hs02_00532680 predicted 746
5 SASI_Hs02_00532681 predicted 646
6 SASI_Hs02_00532682 predicted 731
7 SASI_Hs02_00532683 predicted 682
8 SASI_Hs02_00532684 predicted 652
9 SASI_Hs02_00532685 predicted 748
10 SASI_Hs02_00532686 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532687 predicted 678
2 SASI_Hs02_00532688 predicted 784
3 SASI_Hs02_00532689 predicted 738
4 SASI_Hs02_00532690 predicted 750
5 SASI_Hs02_00532691 predicted 649
6 SASI_Hs02_00532692 predicted 735
7 SASI_Hs02_00532693 predicted 686
8 SASI_Hs02_00532694 predicted 659
9 SASI_Hs02_00532695 predicted 751
10 SASI_Hs02_00532696 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532697 predicted 677
2 SASI_Hs02_00532698 predicted 781
3 SASI_Hs02_00532699 predicted 737
4 SASI_Hs02_00532700 predicted 753
5 SASI_Hs02_00532701 predicted 645
6 SASI_Hs02_00532702 predicted 734
7 SASI_Hs02_00532703 predicted 682
8 SASI_Hs02_00532704 predicted 659
9 SASI_Hs02_00532705 predicted 752
10 SASI_Hs02_00532706 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135570
VALIDATED
C12orf73 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 73
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135570.1-313s21c1
Sequence:CCGGTTTGGGACTGAAAGAAAGAAACTCGAGTTTCTTTCTTTCAGTCCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135570.1-497s21c1
Sequence:CCGGGTTTAGCCGATACGTTGAAATCTCGAGATTTCAACGTATCGGCTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135570.1-283s21c1
Sequence:CCGGACCAAAGCGTGGAGAACTCAACTCGAGTTGAGTTCTCCACGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135570.1-251s21c1
Sequence:CCGGTACCGACCGGACCTGACAATACTCGAGTATTGTCAGGTCCGGTCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135570
VALIDATED
C12orf73 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 73
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135570.1-313s21c1
Sequence:CCGGTTTGGGACTGAAAGAAAGAAACTCGAGTTTCTTTCTTTCAGTCCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135570.1-497s21c1
Sequence:CCGGGTTTAGCCGATACGTTGAAATCTCGAGATTTCAACGTATCGGCTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135570.1-283s21c1
Sequence:CCGGACCAAAGCGTGGAGAACTCAACTCGAGTTGAGTTCTCCACGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135570.1-251s21c1
Sequence:CCGGTACCGACCGGACCTGACAATACTCGAGTATTGTCAGGTCCGGTCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135570
VALIDATED
C12orf73 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 73
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135570.1-313s21c1
Sequence:CCGGTTTGGGACTGAAAGAAAGAAACTCGAGTTTCTTTCTTTCAGTCCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135570.1-497s21c1
Sequence:CCGGGTTTAGCCGATACGTTGAAATCTCGAGATTTCAACGTATCGGCTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135570.1-283s21c1
Sequence:CCGGACCAAAGCGTGGAGAACTCAACTCGAGTTGAGTTCTCCACGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135570.1-251s21c1
Sequence:CCGGTACCGACCGGACCTGACAATACTCGAGTATTGTCAGGTCCGGTCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)