EMAIL THIS PAGE TO A FRIEND

C12orf74

chromosome 12 open reading frame 74

21 Gene Product Result for
Species: Human C12orf74(338809)
UniProtKB ID: Q32Q52, F5H4P0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037671 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146621 MISSION® esiRNA esiRNA human C12orf74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037671 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173276 predicted 777
2 SASI_Hs01_00173277 predicted 797
3 SASI_Hs01_00173278 predicted 930
4 SASI_Hs01_00173281 predicted 501
5 SASI_Hs01_00173282 predicted 715
6 SASI_Hs02_00308347 predicted 852
7 SASI_Hs01_00173283 predicted 966
8 SASI_Hs01_00173284 predicted 749
9 SASI_Hs01_00173285 predicted 570
10 SASI_Hs02_00308348 predicted 1016
11 SASI_Hs01_00173279 predicted 1030
12 SASI_Hs01_00173280 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037671
C12orf74 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 74
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-634s21c1
Sequence:CCGGCTGAGCTTCAGCCTGTCAATGCTCGAGCATTGACAGGCTGAAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-551s21c1
Sequence:CCGGATTGACCTCTGAACCTGAAAGCTCGAGCTTTCAGGTTCAGAGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037671.1-886s21c1
Sequence:CCGGTCAAGTCACTCTTCGCATTTACTCGAGTAAATGCGAAGAGTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-790s21c1
Sequence:CCGGATGACATCTGTTGACTATTTACTCGAGTAAATAGTCAACAGATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-757s21c1
Sequence:CCGGCCAGGTGTGTATGCATTTATTCTCGAGAATAAATGCATACACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037671.1-503s1c1
Sequence:CCGGCCCAAAGGATTCTTCACACTTCTCGAGAAGTGTGAAGAATCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037671
C12orf74 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 74
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-634s21c1
Sequence:CCGGCTGAGCTTCAGCCTGTCAATGCTCGAGCATTGACAGGCTGAAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-551s21c1
Sequence:CCGGATTGACCTCTGAACCTGAAAGCTCGAGCTTTCAGGTTCAGAGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037671.1-886s21c1
Sequence:CCGGTCAAGTCACTCTTCGCATTTACTCGAGTAAATGCGAAGAGTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-790s21c1
Sequence:CCGGATGACATCTGTTGACTATTTACTCGAGTAAATAGTCAACAGATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-757s21c1
Sequence:CCGGCCAGGTGTGTATGCATTTATTCTCGAGAATAAATGCATACACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037671.1-503s1c1
Sequence:CCGGCCCAAAGGATTCTTCACACTTCTCGAGAAGTGTGAAGAATCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037671
C12orf74 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 74
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-634s21c1
Sequence:CCGGCTGAGCTTCAGCCTGTCAATGCTCGAGCATTGACAGGCTGAAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-551s21c1
Sequence:CCGGATTGACCTCTGAACCTGAAAGCTCGAGCTTTCAGGTTCAGAGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037671.1-886s21c1
Sequence:CCGGTCAAGTCACTCTTCGCATTTACTCGAGTAAATGCGAAGAGTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-790s21c1
Sequence:CCGGATGACATCTGTTGACTATTTACTCGAGTAAATAGTCAACAGATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037671.1-757s21c1
Sequence:CCGGCCAGGTGTGTATGCATTTATTCTCGAGAATAAATGCATACACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037671.1-503s1c1
Sequence:CCGGCCCAAAGGATTCTTCACACTTCTCGAGAAGTGTGAAGAATCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks