EMAIL THIS PAGE TO A FRIEND

C12orf75

chromosome 12 open reading frame 75

Synonyms: AGD3 OCC-1 OCC1
Species: Human C12orf75(387882)
Gene ID:
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207376 Rosetta Predictions human pricing
XR_040442 Rosetta Predictions human pricing
XR_040443 Rosetta Predictions human pricing
XR_040444 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245122 predicted 556
2 SASI_Hs01_00245123 predicted 830
3 SASI_Hs01_00245124 predicted 653
4 SASI_Hs01_00245125 predicted 431
5 SASI_Hs01_00245126 predicted 319
6 SASI_Hs01_00245127 predicted 420
7 SASI_Hs01_00245128 predicted 861
8 SASI_Hs01_00245129 predicted 470
9 SASI_Hs01_00245130 predicted 415
10 SASI_Hs01_00245131 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518921 predicted 639
2 SASI_Hs02_00518922 predicted 755
3 SASI_Hs02_00518923 predicted 1180
4 SASI_Hs02_00518924 predicted 952
5 SASI_Hs02_00518925 predicted 840
6 SASI_Hs02_00518926 predicted 943
7 SASI_Hs02_00518927 predicted 699
8 SASI_Hs02_00518928 predicted 955
9 SASI_Hs02_00518929 predicted 1347
10 SASI_Hs02_00518930 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518931 predicted 633
2 SASI_Hs02_00518932 predicted 755
3 SASI_Hs02_00518933 predicted 1181
4 SASI_Hs02_00518934 predicted 950
5 SASI_Hs02_00518935 predicted 840
6 SASI_Hs02_00518936 predicted 945
7 SASI_Hs02_00518937 predicted 696
8 SASI_Hs02_00518938 predicted 955
9 SASI_Hs02_00518939 predicted 1348
10 SASI_Hs02_00518940 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518941 predicted 633
2 SASI_Hs02_00518942 predicted 759
3 SASI_Hs02_00518943 predicted 1174
4 SASI_Hs02_00518944 predicted 950
5 SASI_Hs02_00518945 predicted 842
6 SASI_Hs02_00518946 predicted 952
7 SASI_Hs02_00518947 predicted 700
8 SASI_Hs02_00518948 predicted 962
9 SASI_Hs02_00518949 predicted 1356
10 SASI_Hs02_00518950 predicted 939
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207376
VALIDATED
C12orf75 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 75
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207376.1-955s1c1
Sequence:CCGGGCTCATTCTACATCACGACAACTCGAGTTGTCGTGATGTAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-405s1c1
Sequence:CCGGGTAATAGAAGGGAATTGGTTACTCGAGTAACCAATTCCCTTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-322s1c1
Sequence:CCGGGAAATTCTAAACAGTCACCCTCTCGAGAGGGTGACTGTTTAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-458s1c1
Sequence:CCGGCCACCTACGAAAGACAAGTTACTCGAGTAACTTGTCTTTCGTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-294s1c1
Sequence:CCGGCGTTGTAATGTGCACAGACATCTCGAGATGTCTGTGCACATTACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207376
VALIDATED
C12orf75 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 75
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207376.1-955s1c1
Sequence:CCGGGCTCATTCTACATCACGACAACTCGAGTTGTCGTGATGTAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-405s1c1
Sequence:CCGGGTAATAGAAGGGAATTGGTTACTCGAGTAACCAATTCCCTTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-322s1c1
Sequence:CCGGGAAATTCTAAACAGTCACCCTCTCGAGAGGGTGACTGTTTAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-458s1c1
Sequence:CCGGCCACCTACGAAAGACAAGTTACTCGAGTAACTTGTCTTTCGTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-294s1c1
Sequence:CCGGCGTTGTAATGTGCACAGACATCTCGAGATGTCTGTGCACATTACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207376
VALIDATED
C12orf75 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 75
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207376.1-955s1c1
Sequence:CCGGGCTCATTCTACATCACGACAACTCGAGTTGTCGTGATGTAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-405s1c1
Sequence:CCGGGTAATAGAAGGGAATTGGTTACTCGAGTAACCAATTCCCTTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-322s1c1
Sequence:CCGGGAAATTCTAAACAGTCACCCTCTCGAGAGGGTGACTGTTTAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-458s1c1
Sequence:CCGGCCACCTACGAAAGACAAGTTACTCGAGTAACTTGTCTTTCGTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_207376.1-294s1c1
Sequence:CCGGCGTTGTAATGTGCACAGACATCTCGAGATGTCTGTGCACATTACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks