EMAIL THIS PAGE TO A FRIEND

C12orf76

chromosome 12 open reading frame 76

49 Gene Product Result for
Species: Human C12orf76(400073)
UniProtKB ID: Q8N812
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207435 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068593 predicted 833
2 SASI_Hs01_00068589 predicted 856
3 SASI_Hs01_00068590 predicted 957
4 SASI_Hs01_00068591 predicted 811
5 SASI_Hs01_00068594 predicted 895
6 SASI_Hs01_00068592 predicted 922
7 SASI_Hs01_00068596 predicted 1062
8 SASI_Hs02_00374075 predicted 1126
9 SASI_Hs02_00374076 predicted 1079
10 SASI_Hs02_00374077 predicted 1124
11 SASI_Hs01_00068595 predicted 927
12 SASI_Hs01_00068597 predicted 993
13 SASI_Hs01_00068598 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207435
C12orf76 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 76
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207435.1-1340s1c1
Sequence:CCGGCCTGTTACTATATGCACCTTTCTCGAGAAAGGTGCATATAGTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207435.1-517s1c1
Sequence:CCGGGCTTCATTCATACCACAGTTTCTCGAGAAACTGTGGTATGAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207435.1-1067s1c1
Sequence:CCGGGCCTGTAAGAACCACACTGTACTCGAGTACAGTGTGGTTCTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207435.1-608s1c1
Sequence:CCGGGCTTGAAGAACAATCTAACCACTCGAGTGGTTAGATTGTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-700s21c1
Sequence:CCGGACTGTCATCCTTATGGCATTTCTCGAGAAATGCCATAAGGATGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-417s21c1
Sequence:CCGGCCATTTACCATAGCATTTAAGCTCGAGCTTAAATGCTATGGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-744s21c1
Sequence:CCGGTCGGTGACAGCCAGACAAGTTCTCGAGAACTTGTCTGGCTGTCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207435.1-920s21c1
Sequence:CCGGTCCTAACACTGTAGCGCAAATCTCGAGATTTGCGCTACAGTGTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-766s21c1
Sequence:CCGGTTCAATGAGTATTTGGGAATACTCGAGTATTCCCAAATACTCATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207435
C12orf76 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 76
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207435.1-1340s1c1
Sequence:CCGGCCTGTTACTATATGCACCTTTCTCGAGAAAGGTGCATATAGTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207435.1-517s1c1
Sequence:CCGGGCTTCATTCATACCACAGTTTCTCGAGAAACTGTGGTATGAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207435.1-1067s1c1
Sequence:CCGGGCCTGTAAGAACCACACTGTACTCGAGTACAGTGTGGTTCTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207435.1-608s1c1
Sequence:CCGGGCTTGAAGAACAATCTAACCACTCGAGTGGTTAGATTGTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-700s21c1
Sequence:CCGGACTGTCATCCTTATGGCATTTCTCGAGAAATGCCATAAGGATGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-417s21c1
Sequence:CCGGCCATTTACCATAGCATTTAAGCTCGAGCTTAAATGCTATGGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-744s21c1
Sequence:CCGGTCGGTGACAGCCAGACAAGTTCTCGAGAACTTGTCTGGCTGTCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207435.1-920s21c1
Sequence:CCGGTCCTAACACTGTAGCGCAAATCTCGAGATTTGCGCTACAGTGTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-766s21c1
Sequence:CCGGTTCAATGAGTATTTGGGAATACTCGAGTATTCCCAAATACTCATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207435
C12orf76 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 76
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207435.1-1340s1c1
Sequence:CCGGCCTGTTACTATATGCACCTTTCTCGAGAAAGGTGCATATAGTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207435.1-517s1c1
Sequence:CCGGGCTTCATTCATACCACAGTTTCTCGAGAAACTGTGGTATGAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207435.1-1067s1c1
Sequence:CCGGGCCTGTAAGAACCACACTGTACTCGAGTACAGTGTGGTTCTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207435.1-608s1c1
Sequence:CCGGGCTTGAAGAACAATCTAACCACTCGAGTGGTTAGATTGTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-700s21c1
Sequence:CCGGACTGTCATCCTTATGGCATTTCTCGAGAAATGCCATAAGGATGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-417s21c1
Sequence:CCGGCCATTTACCATAGCATTTAAGCTCGAGCTTAAATGCTATGGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-744s21c1
Sequence:CCGGTCGGTGACAGCCAGACAAGTTCTCGAGAACTTGTCTGGCTGTCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207435.1-920s21c1
Sequence:CCGGTCCTAACACTGTAGCGCAAATCTCGAGATTTGCGCTACAGTGTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207435.1-766s21c1
Sequence:CCGGTTCAATGAGTATTTGGGAATACTCGAGTATTCCCAAATACTCATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks