EMAIL THIS PAGE TO A FRIEND

C12orf77

chromosome 12 open reading frame 77

16 Gene Product Result for
Species: Human C12orf77(196415)
UniProtKB ID: C9JDV5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101339 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029631 MISSION® esiRNA esiRNA human AC096772.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101339 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322645 predicted 512
2 SASI_Hs02_00322646 predicted 425
3 SASI_Hs02_00322647 predicted 609
4 SASI_Hs02_00322648 predicted 609
5 SASI_Hs02_00322649 predicted 572
6 SASI_Hs02_00322650 predicted 417
7 SASI_Hs02_00322651 predicted 508
8 SASI_Hs02_00322652 predicted 515
9 SASI_Hs02_00322653 predicted 421
10 SASI_Hs02_00322654 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101339
C12orf77 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 77
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-236s21c1
Sequence:CCGGATTTCCCTCCTAGTCATAAAGCTCGAGCTTTATGACTAGGAGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-505s21c1
Sequence:CCGGTCCAACCCTGAGCACGTTTATCTCGAGATAAACGTGCTCAGGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-461s21c1
Sequence:CCGGCCCGAATGCCACCAGAAATATCTCGAGATATTTCTGGTGGCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101339.1-1220s21c1
Sequence:CCGGCTTAACCCTGCCTACACTTTCCTCGAGGAAAGTGTAGGCAGGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101339
C12orf77 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 77
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-236s21c1
Sequence:CCGGATTTCCCTCCTAGTCATAAAGCTCGAGCTTTATGACTAGGAGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-505s21c1
Sequence:CCGGTCCAACCCTGAGCACGTTTATCTCGAGATAAACGTGCTCAGGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-461s21c1
Sequence:CCGGCCCGAATGCCACCAGAAATATCTCGAGATATTTCTGGTGGCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101339.1-1220s21c1
Sequence:CCGGCTTAACCCTGCCTACACTTTCCTCGAGGAAAGTGTAGGCAGGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101339
C12orf77 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 77
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-236s21c1
Sequence:CCGGATTTCCCTCCTAGTCATAAAGCTCGAGCTTTATGACTAGGAGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-505s21c1
Sequence:CCGGTCCAACCCTGAGCACGTTTATCTCGAGATAAACGTGCTCAGGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101339.1-461s21c1
Sequence:CCGGCCCGAATGCCACCAGAAATATCTCGAGATATTTCTGGTGGCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101339.1-1220s21c1
Sequence:CCGGCTTAACCCTGCCTACACTTTCCTCGAGGAAAGTGTAGGCAGGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks