EMAIL THIS PAGE TO A FRIEND

C13orf35

chromosome 13 open reading frame 35

23 Gene Product Result for
Synonyms: SMABLO1
Species: Human C13orf35(400165)
UniProtKB ID: Q6ZP68
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375038 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207440 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114052 predicted 1343
2 SASI_Hs01_00114053 predicted 1128
3 SASI_Hs01_00114054 predicted 1330
4 SASI_Hs01_00114055 predicted 1202
5 SASI_Hs01_00114056 predicted 1103
6 SASI_Hs01_00114057 predicted 1478
7 SASI_Hs01_00114058 predicted 1042
8 SASI_Hs01_00114060 predicted 1240
9 SASI_Hs01_00114061 predicted 1082
10 SASI_Hs02_00374084 predicted 1057
11 SASI_Hs01_00114059 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207440
C13orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 13 open reading frame 35
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000148913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207440.1-1970s1c1
Sequence:CCGGCCTCCCAATTCCTATGTGATTCTCGAGAATCACATAGGAATTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1080s1c1
Sequence:CCGGCAGACAGATGATTCCAACAAACTCGAGTTTGTTGGAATCATCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1021s1c1
Sequence:CCGGCCCTATCATCTTTACTCTGTTCTCGAGAACAGAGTAAAGATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1071s1c1
Sequence:CCGGGTTACTGTTCAGACAGATGATCTCGAGATCATCTGTCTGAACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207440
C13orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 13 open reading frame 35
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000148913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207440.1-1970s1c1
Sequence:CCGGCCTCCCAATTCCTATGTGATTCTCGAGAATCACATAGGAATTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1080s1c1
Sequence:CCGGCAGACAGATGATTCCAACAAACTCGAGTTTGTTGGAATCATCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1021s1c1
Sequence:CCGGCCCTATCATCTTTACTCTGTTCTCGAGAACAGAGTAAAGATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1071s1c1
Sequence:CCGGGTTACTGTTCAGACAGATGATCTCGAGATCATCTGTCTGAACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207440
C13orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 13 open reading frame 35
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000148913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207440.1-1970s1c1
Sequence:CCGGCCTCCCAATTCCTATGTGATTCTCGAGAATCACATAGGAATTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1080s1c1
Sequence:CCGGCAGACAGATGATTCCAACAAACTCGAGTTTGTTGGAATCATCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1021s1c1
Sequence:CCGGCCCTATCATCTTTACTCTGTTCTCGAGAACAGAGTAAAGATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207440.1-1071s1c1
Sequence:CCGGGTTACTGTTCAGACAGATGATCTCGAGATCATCTGTCTGAACAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375038
C13orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 13 open reading frame 35
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000131224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375038.1-1448s1c1
Sequence:CCGGGCATCTGAACACCTGAAGGAACTCGAGTTCCTTCAGGTGTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375038.1-1131s1c1
Sequence:CCGGGCACTACACAACTTAGTTGTTCTCGAGAACAACTAAGTTGTGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375038.1-1045s1c1
Sequence:CCGGGAGGAGCTATAATGGTCTATACTCGAGTATAGACCATTATAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375038.1-1013s1c1
Sequence:CCGGGCCAGATACCCTATCATCTTTCTCGAGAAAGATGATAGGGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375038
C13orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 13 open reading frame 35
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000131224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375038.1-1448s1c1
Sequence:CCGGGCATCTGAACACCTGAAGGAACTCGAGTTCCTTCAGGTGTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375038.1-1131s1c1
Sequence:CCGGGCACTACACAACTTAGTTGTTCTCGAGAACAACTAAGTTGTGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375038.1-1045s1c1
Sequence:CCGGGAGGAGCTATAATGGTCTATACTCGAGTATAGACCATTATAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375038.1-1013s1c1
Sequence:CCGGGCCAGATACCCTATCATCTTTCTCGAGAAAGATGATAGGGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375038
C13orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 13 open reading frame 35
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000131224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375038.1-1448s1c1
Sequence:CCGGGCATCTGAACACCTGAAGGAACTCGAGTTCCTTCAGGTGTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375038.1-1131s1c1
Sequence:CCGGGCACTACACAACTTAGTTGTTCTCGAGAACAACTAAGTTGTGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375038.1-1045s1c1
Sequence:CCGGGAGGAGCTATAATGGTCTATACTCGAGTATAGACCATTATAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375038.1-1013s1c1
Sequence:CCGGGCCAGATACCCTATCATCTTTCTCGAGAAAGATGATAGGGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks