EMAIL THIS PAGE TO A FRIEND

C14orf105

chromosome 14 open reading frame 105

76 Gene Product Result for
Species: Human C14orf105(55195)
UniProtKB ID: Q9NVL8, Q53G04
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018168 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018991 MISSION® esiRNA esiRNA targeting human C14orf105 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018168 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159853 predicted 558
2 SASI_Hs01_00159854 predicted 451
3 SASI_Hs01_00159855 predicted 236
4 SASI_Hs01_00159856 predicted 446
5 SASI_Hs01_00159857 predicted 340
6 SASI_Hs01_00159858 predicted 675
7 SASI_Hs01_00159859 predicted 576
8 SASI_Hs01_00159860 predicted 728
9 SASI_Hs01_00159861 predicted 505
10 SASI_Hs01_00159862 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018168
VALIDATED
C14orf105 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 105
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-365s21c1
Sequence:CCGGAGCATCCAGAGACATGTATTTCTCGAGAAATACATGTCTCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-784s21c1
Sequence:CCGGTGAACAGAGGTCCCGGAAATTCTCGAGAATTTCCGGGACCTCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-609s21c1
Sequence:CCGGGTGCTGGAAATGATCCGTAAACTCGAGTTTACGGATCATTTCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-461s21c1
Sequence:CCGGCATTGACTTGCCACGAGTAATCTCGAGATTACTCGTGGCAAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018168.2-288s21c1
Sequence:CCGGAGACTGCAGGACCAGAATAAACTCGAGTTTATTCTGGTCCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018168.2-690s21c1
Sequence:CCGGCAAAGTCCAAGGGACCATAAACTCGAGTTTATGGTCCCTTGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018168.1-465s1c1
Sequence:CCGGCCACGAGTAATTACTTCAGGACTCGAGTCCTGAAGTAATTACTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018168.1-1549s1c1
Sequence:CCGGGCTAGTCATAGAACTGACTTTCTCGAGAAAGTCAGTTCTATGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018168.1-2195s1c1
Sequence:CCGGCGTGAGATAATGTCACGTGTACTCGAGTACACGTGACATTATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018168.1-787s1c1
Sequence:CCGGGTCCCGGAAATTCAAAGGATACTCGAGTATCCTTTGAATTTCCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018168.1-1579s1c1
Sequence:CCGGCCACCATGTTCTGTTGGTTAACTCGAGTTAACCAACAGAACATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018168
VALIDATED
C14orf105 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 105
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-365s21c1
Sequence:CCGGAGCATCCAGAGACATGTATTTCTCGAGAAATACATGTCTCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-784s21c1
Sequence:CCGGTGAACAGAGGTCCCGGAAATTCTCGAGAATTTCCGGGACCTCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-609s21c1
Sequence:CCGGGTGCTGGAAATGATCCGTAAACTCGAGTTTACGGATCATTTCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-461s21c1
Sequence:CCGGCATTGACTTGCCACGAGTAATCTCGAGATTACTCGTGGCAAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018168.2-288s21c1
Sequence:CCGGAGACTGCAGGACCAGAATAAACTCGAGTTTATTCTGGTCCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018168.2-690s21c1
Sequence:CCGGCAAAGTCCAAGGGACCATAAACTCGAGTTTATGGTCCCTTGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018168.1-465s1c1
Sequence:CCGGCCACGAGTAATTACTTCAGGACTCGAGTCCTGAAGTAATTACTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018168.1-1549s1c1
Sequence:CCGGGCTAGTCATAGAACTGACTTTCTCGAGAAAGTCAGTTCTATGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018168.1-2195s1c1
Sequence:CCGGCGTGAGATAATGTCACGTGTACTCGAGTACACGTGACATTATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018168.1-787s1c1
Sequence:CCGGGTCCCGGAAATTCAAAGGATACTCGAGTATCCTTTGAATTTCCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018168.1-1579s1c1
Sequence:CCGGCCACCATGTTCTGTTGGTTAACTCGAGTTAACCAACAGAACATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018168
VALIDATED
C14orf105 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 105
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-365s21c1
Sequence:CCGGAGCATCCAGAGACATGTATTTCTCGAGAAATACATGTCTCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-784s21c1
Sequence:CCGGTGAACAGAGGTCCCGGAAATTCTCGAGAATTTCCGGGACCTCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-609s21c1
Sequence:CCGGGTGCTGGAAATGATCCGTAAACTCGAGTTTACGGATCATTTCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018168.2-461s21c1
Sequence:CCGGCATTGACTTGCCACGAGTAATCTCGAGATTACTCGTGGCAAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018168.2-288s21c1
Sequence:CCGGAGACTGCAGGACCAGAATAAACTCGAGTTTATTCTGGTCCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018168.2-690s21c1
Sequence:CCGGCAAAGTCCAAGGGACCATAAACTCGAGTTTATGGTCCCTTGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018168.1-465s1c1
Sequence:CCGGCCACGAGTAATTACTTCAGGACTCGAGTCCTGAAGTAATTACTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018168.1-1549s1c1
Sequence:CCGGGCTAGTCATAGAACTGACTTTCTCGAGAAAGTCAGTTCTATGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018168.1-2195s1c1
Sequence:CCGGCGTGAGATAATGTCACGTGTACTCGAGTACACGTGACATTATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018168.1-787s1c1
Sequence:CCGGGTCCCGGAAATTCAAAGGATACTCGAGTATCCTTTGAATTTCCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018168.1-1579s1c1
Sequence:CCGGCCACCATGTTCTGTTGGTTAACTCGAGTTAACCAACAGAACATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks