EMAIL THIS PAGE TO A FRIEND

C14orf119

chromosome 14 open reading frame 119

40 Gene Product Result for
Species: Human C14orf119(55017)
UniProtKB ID: Q9NWQ9, Q6IAA7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003638 Anti-C14orf119 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017924 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119211 MISSION® esiRNA esiRNA human C14orf119 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017924 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350921 predicted 712
2 SASI_Hs01_00213136 predicted 537
3 SASI_Hs01_00213137 predicted 668
4 SASI_Hs01_00213139 predicted 617
5 SASI_Hs01_00213140 predicted 402
6 SASI_Hs02_00350922 predicted 689
7 SASI_Hs01_00213141 predicted 318
8 SASI_Hs01_00213142 predicted 313
9 SASI_Hs02_00350923 predicted 506
10 SASI_Hs02_00350924 predicted 526
11 SASI_Hs01_00213133 predicted 523
12 SASI_Hs01_00213134 predicted 764
13 SASI_Hs01_00213135 predicted 378
14 SASI_Hs01_00213138 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017924
VALIDATED
C14orf119 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 119
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017924.2-132s1c1
Sequence:CCGGGATGTCTTACATCACCTCCCACTCGAGTGGGAGGTGATGTAAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017924.2-364s1c1
Sequence:CCGGGAGCAGGAGCGCAATGAATTTCTCGAGAAATTCATTGCGCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017924.2-1192s1c1
Sequence:CCGGCGCACAACAATATCTGGCTAACTCGAGTTAGCCAGATATTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017924.2-95s1c1
Sequence:CCGGCCTCAGTACCACACAATACTACTCGAGTAGTATTGTGTGGTACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017924.2-151s1c1
Sequence:CCGGCAGGAGATGAAGTGTATTCTTCTCGAGAAGAATACACTTCATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017924.2-100s1c1
Sequence:CCGGGTACCACACAATACTAACCCTCTCGAGAGGGTTAGTATTGTGTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-95s21c1
Sequence:CCGGCCTCAGTACCACACAATACTACTCGAGTAGTATTGTGTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-454s21c1
Sequence:CCGGGGTAAGGACTGATAGGCATTCCTCGAGGAATGCCTATCAGTCCTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-299s21c1
Sequence:CCGGACCGACCACCTTCTATCTTTGCTCGAGCAAAGATAGAAGGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-364s21c1
Sequence:CCGGGAGCAGGAGCGCAATGAATTTCTCGAGAAATTCATTGCGCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-594s21c1
Sequence:CCGGCCAGTACAGGCATGGTTATTTCTCGAGAAATAACCATGCCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017924
VALIDATED
C14orf119 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 119
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017924.2-132s1c1
Sequence:CCGGGATGTCTTACATCACCTCCCACTCGAGTGGGAGGTGATGTAAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017924.2-364s1c1
Sequence:CCGGGAGCAGGAGCGCAATGAATTTCTCGAGAAATTCATTGCGCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017924.2-1192s1c1
Sequence:CCGGCGCACAACAATATCTGGCTAACTCGAGTTAGCCAGATATTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017924.2-95s1c1
Sequence:CCGGCCTCAGTACCACACAATACTACTCGAGTAGTATTGTGTGGTACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017924.2-151s1c1
Sequence:CCGGCAGGAGATGAAGTGTATTCTTCTCGAGAAGAATACACTTCATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017924.2-100s1c1
Sequence:CCGGGTACCACACAATACTAACCCTCTCGAGAGGGTTAGTATTGTGTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-95s21c1
Sequence:CCGGCCTCAGTACCACACAATACTACTCGAGTAGTATTGTGTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-454s21c1
Sequence:CCGGGGTAAGGACTGATAGGCATTCCTCGAGGAATGCCTATCAGTCCTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-299s21c1
Sequence:CCGGACCGACCACCTTCTATCTTTGCTCGAGCAAAGATAGAAGGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-364s21c1
Sequence:CCGGGAGCAGGAGCGCAATGAATTTCTCGAGAAATTCATTGCGCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-594s21c1
Sequence:CCGGCCAGTACAGGCATGGTTATTTCTCGAGAAATAACCATGCCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017924
VALIDATED
C14orf119 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 119
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017924.2-132s1c1
Sequence:CCGGGATGTCTTACATCACCTCCCACTCGAGTGGGAGGTGATGTAAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017924.2-364s1c1
Sequence:CCGGGAGCAGGAGCGCAATGAATTTCTCGAGAAATTCATTGCGCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017924.2-1192s1c1
Sequence:CCGGCGCACAACAATATCTGGCTAACTCGAGTTAGCCAGATATTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017924.2-95s1c1
Sequence:CCGGCCTCAGTACCACACAATACTACTCGAGTAGTATTGTGTGGTACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017924.2-151s1c1
Sequence:CCGGCAGGAGATGAAGTGTATTCTTCTCGAGAAGAATACACTTCATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017924.2-100s1c1
Sequence:CCGGGTACCACACAATACTAACCCTCTCGAGAGGGTTAGTATTGTGTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-95s21c1
Sequence:CCGGCCTCAGTACCACACAATACTACTCGAGTAGTATTGTGTGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-454s21c1
Sequence:CCGGGGTAAGGACTGATAGGCATTCCTCGAGGAATGCCTATCAGTCCTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-299s21c1
Sequence:CCGGACCGACCACCTTCTATCTTTGCTCGAGCAAAGATAGAAGGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-364s21c1
Sequence:CCGGGAGCAGGAGCGCAATGAATTTCTCGAGAAATTCATTGCGCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017924.2-594s21c1
Sequence:CCGGCCAGTACAGGCATGGTTATTTCTCGAGAAATAACCATGCCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks