EMAIL THIS PAGE TO A FRIEND

C14orf132

chromosome 14 open reading frame 132

Synonyms: C14orf88
Species: Human C14orf132(56967)
UniProtKB ID: Q9NPU4, B2R7K5
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020215 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020215 Rosetta Predictions human pricing
XR_040536 Rosetta Predictions human pricing
XR_040537 Rosetta Predictions human pricing
XR_040538 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038825 predicted 4734
2 SASI_Hs01_00038826 predicted 4783
3 SASI_Hs01_00038827 predicted 4785
4 SASI_Hs01_00038828 predicted 4710
5 SASI_Hs01_00038829 predicted 4739
6 SASI_Hs01_00038830 predicted 4610
7 SASI_Hs01_00038831 predicted 4722
8 SASI_Hs01_00038832 predicted 4562
9 SASI_Hs01_00038833 predicted 4513
10 SASI_Hs01_00038834 predicted 4719
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519774 predicted 1049
2 SASI_Hs02_00519775 predicted 280
3 SASI_Hs02_00519776 predicted 4912
4 SASI_Hs02_00519777 predicted 7272
5 SASI_Hs02_00519778 predicted 878
6 SASI_Hs02_00519779 predicted 5869
7 SASI_Hs02_00519780 predicted 4786
8 SASI_Hs02_00519781 predicted 863
9 SASI_Hs02_00519782 predicted 6256
10 SASI_Hs02_00519783 predicted 4731
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519784 predicted 1046
2 SASI_Hs02_00519785 predicted 281
3 SASI_Hs02_00519786 predicted 4910
4 SASI_Hs02_00519787 predicted 7269
5 SASI_Hs02_00519788 predicted 871
6 SASI_Hs02_00519789 predicted 5863
7 SASI_Hs02_00519790 predicted 4785
8 SASI_Hs02_00519791 predicted 859
9 SASI_Hs02_00519792 predicted 6251
10 SASI_Hs02_00519793 predicted 4729
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519794 predicted 282
2 SASI_Hs02_00519795 predicted 4909
3 SASI_Hs02_00519796 predicted 7270
4 SASI_Hs02_00519797 predicted 874
5 SASI_Hs02_00519798 predicted 4905
6 SASI_Hs02_00519799 predicted 5868
7 SASI_Hs02_00519800 predicted 4781
8 SASI_Hs02_00519801 predicted 863
9 SASI_Hs02_00519802 predicted 6251
10 SASI_Hs02_00519803 predicted 7262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020215
C14orf132 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 132
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020215.2-5848s1c1
Sequence:CCGGGCAGAGAATGACGTGGACATTCTCGAGAATGTCCACGTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4552s1c1
Sequence:CCGGCTGCAAGACAAATGGCACTTTCTCGAGAAAGTGCCATTTGTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4327s1c1
Sequence:CCGGGAGAAATGATTCTCGCTCCTTCTCGAGAAGGAGCGAGAATCATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4594s1c1
Sequence:CCGGGCCTTCATTATTAGCAGTAATCTCGAGATTACTGCTAATAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4593s1c1
Sequence:CCGGTGCCTTCATTATTAGCAGTAACTCGAGTTACTGCTAATAATGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020215
C14orf132 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 132
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020215.2-5848s1c1
Sequence:CCGGGCAGAGAATGACGTGGACATTCTCGAGAATGTCCACGTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4552s1c1
Sequence:CCGGCTGCAAGACAAATGGCACTTTCTCGAGAAAGTGCCATTTGTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4327s1c1
Sequence:CCGGGAGAAATGATTCTCGCTCCTTCTCGAGAAGGAGCGAGAATCATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4594s1c1
Sequence:CCGGGCCTTCATTATTAGCAGTAATCTCGAGATTACTGCTAATAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4593s1c1
Sequence:CCGGTGCCTTCATTATTAGCAGTAACTCGAGTTACTGCTAATAATGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020215
C14orf132 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 132
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020215.2-5848s1c1
Sequence:CCGGGCAGAGAATGACGTGGACATTCTCGAGAATGTCCACGTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4552s1c1
Sequence:CCGGCTGCAAGACAAATGGCACTTTCTCGAGAAAGTGCCATTTGTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4327s1c1
Sequence:CCGGGAGAAATGATTCTCGCTCCTTCTCGAGAAGGAGCGAGAATCATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4594s1c1
Sequence:CCGGGCCTTCATTATTAGCAGTAATCTCGAGATTACTGCTAATAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020215.2-4593s1c1
Sequence:CCGGTGCCTTCATTATTAGCAGTAACTCGAGTTACTGCTAATAATGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks