EMAIL THIS PAGE TO A FRIEND

C14orf142

chromosome 14 open reading frame 142

26 Gene Product Result for
Synonyms: PNAS-127
Species: Human C14orf142(84520)
UniProtKB ID: Q9BXV9, Q0D2N1, Q0P6C4, Q3B7W5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032490 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144671 MISSION® esiRNA esiRNA human C14orf142 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032490 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359950 predicted 199
2 SASI_Hs02_00359951 predicted 362
3 SASI_Hs02_00359952 predicted 744
4 SASI_Hs02_00359953 predicted 478
5 SASI_Hs02_00359954 predicted 442
6 SASI_Hs02_00359955 predicted 630
7 SASI_Hs01_00141099 predicted 421
8 SASI_Hs02_00359956 predicted 682
9 SASI_Hs01_00141100 predicted 731
10 SASI_Hs02_00359957 predicted 873
11 SASI_Hs01_00141091 predicted 424
12 SASI_Hs01_00141092 predicted 512
13 SASI_Hs01_00141093 predicted 721
14 SASI_Hs01_00141094 predicted 868
15 SASI_Hs01_00141095 predicted 605
16 SASI_Hs01_00141096 predicted 754
17 SASI_Hs01_00141097 predicted 880
18 SASI_Hs01_00141098 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032490
VALIDATED
C14orf142 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 142
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-519s1c1
Sequence:CCGGGCAAAGATAGTAAAGGCTTAGCTCGAGCTAAGCCTTTACTATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-431s1c1
Sequence:CCGGGAAGACTTATGCTCTAATTTGCTCGAGCAAATTAGAGCATAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-520s1c1
Sequence:CCGGCAAAGATAGTAAAGGCTTAGACTCGAGTCTAAGCCTTTACTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-510s1c1
Sequence:CCGGCTGTTTCTAGCAAAGATAGTACTCGAGTACTATCTTTGCTAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032490.2-559s1c1
Sequence:CCGGGAGAAATAAATTTCAGACCCTCTCGAGAGGGTCTGAAATTTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032490.2-421s1c1
Sequence:CCGGGACATTTAAGGAAGACTTATGCTCGAGCATAAGTCTTCCTTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-745s21c1
Sequence:CCGGGGTTCATAGGCAGTAACATTTCTCGAGAAATGTTACTGCCTATGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-767s21c1
Sequence:CCGGAGAGAACTGACATGAACAAGTCTCGAGACTTGTTCATGTCAGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-632s21c1
Sequence:CCGGTCTAAGTTGGCAACTGAATTTCTCGAGAAATTCAGTTGCCAACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-815s21c1
Sequence:CCGGATAACAGTTCTTCATAAACAGCTCGAGCTGTTTATGAAGAACTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-685s21c1
Sequence:CCGGTGATTTGTGTGATGTCTACATCTCGAGATGTAGACATCACACAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032490.4-199s21c1
Sequence:CCGGAGGACATGGTAACGGAATTATCTCGAGATAATTCCGTTACCATGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032490
VALIDATED
C14orf142 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 142
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-519s1c1
Sequence:CCGGGCAAAGATAGTAAAGGCTTAGCTCGAGCTAAGCCTTTACTATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-431s1c1
Sequence:CCGGGAAGACTTATGCTCTAATTTGCTCGAGCAAATTAGAGCATAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-520s1c1
Sequence:CCGGCAAAGATAGTAAAGGCTTAGACTCGAGTCTAAGCCTTTACTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-510s1c1
Sequence:CCGGCTGTTTCTAGCAAAGATAGTACTCGAGTACTATCTTTGCTAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032490.2-559s1c1
Sequence:CCGGGAGAAATAAATTTCAGACCCTCTCGAGAGGGTCTGAAATTTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032490.2-421s1c1
Sequence:CCGGGACATTTAAGGAAGACTTATGCTCGAGCATAAGTCTTCCTTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-745s21c1
Sequence:CCGGGGTTCATAGGCAGTAACATTTCTCGAGAAATGTTACTGCCTATGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-767s21c1
Sequence:CCGGAGAGAACTGACATGAACAAGTCTCGAGACTTGTTCATGTCAGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-632s21c1
Sequence:CCGGTCTAAGTTGGCAACTGAATTTCTCGAGAAATTCAGTTGCCAACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-815s21c1
Sequence:CCGGATAACAGTTCTTCATAAACAGCTCGAGCTGTTTATGAAGAACTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-685s21c1
Sequence:CCGGTGATTTGTGTGATGTCTACATCTCGAGATGTAGACATCACACAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032490.4-199s21c1
Sequence:CCGGAGGACATGGTAACGGAATTATCTCGAGATAATTCCGTTACCATGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032490
VALIDATED
C14orf142 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 142
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-519s1c1
Sequence:CCGGGCAAAGATAGTAAAGGCTTAGCTCGAGCTAAGCCTTTACTATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-431s1c1
Sequence:CCGGGAAGACTTATGCTCTAATTTGCTCGAGCAAATTAGAGCATAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-520s1c1
Sequence:CCGGCAAAGATAGTAAAGGCTTAGACTCGAGTCTAAGCCTTTACTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032490.2-510s1c1
Sequence:CCGGCTGTTTCTAGCAAAGATAGTACTCGAGTACTATCTTTGCTAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032490.2-559s1c1
Sequence:CCGGGAGAAATAAATTTCAGACCCTCTCGAGAGGGTCTGAAATTTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032490.2-421s1c1
Sequence:CCGGGACATTTAAGGAAGACTTATGCTCGAGCATAAGTCTTCCTTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-745s21c1
Sequence:CCGGGGTTCATAGGCAGTAACATTTCTCGAGAAATGTTACTGCCTATGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-767s21c1
Sequence:CCGGAGAGAACTGACATGAACAAGTCTCGAGACTTGTTCATGTCAGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-632s21c1
Sequence:CCGGTCTAAGTTGGCAACTGAATTTCTCGAGAAATTCAGTTGCCAACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-815s21c1
Sequence:CCGGATAACAGTTCTTCATAAACAGCTCGAGCTGTTTATGAAGAACTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032490.4-685s21c1
Sequence:CCGGTGATTTGTGTGATGTCTACATCTCGAGATGTAGACATCACACAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032490.4-199s21c1
Sequence:CCGGAGGACATGGTAACGGAATTATCTCGAGATAATTCCGTTACCATGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks