EMAIL THIS PAGE TO A FRIEND

C14orf159

chromosome 14 open reading frame 159

Gene ID:
Zebrafish(560387) c14orf159 homolog (H. sapiens)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024952 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075871 MISSION® esiRNA esiRNA human C14orf159 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102366 Rosetta Predictions human pricing
NM_001102367 Rosetta Predictions human pricing
NM_001102368 Rosetta Predictions human pricing
NM_001102369 Rosetta Predictions human pricing
NM_024952 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322983 predicted 2709
2 SASI_Hs02_00322984 predicted 2747
3 SASI_Hs02_00322985 predicted 1953
4 SASI_Hs02_00322986 predicted 1632
5 SASI_Hs02_00322987 predicted 1693
6 SASI_Hs02_00322988 predicted 1582
7 SASI_Hs02_00322989 predicted 1724
8 SASI_Hs02_00322990 predicted 2618
9 SASI_Hs02_00322991 predicted 1878
10 SASI_Hs02_00322992 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322993 predicted 2479
2 SASI_Hs02_00322994 predicted 2512
3 SASI_Hs02_00322995 predicted 1726
4 SASI_Hs02_00322996 predicted 1399
5 SASI_Hs02_00322997 predicted 1462
6 SASI_Hs02_00322998 predicted 1346
7 SASI_Hs02_00322999 predicted 1486
8 SASI_Hs02_00323000 predicted 2384
9 SASI_Hs02_00323001 predicted 1645
10 SASI_Hs02_00323002 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323003 predicted 2313
2 SASI_Hs02_00323004 predicted 2343
3 SASI_Hs02_00323005 predicted 1557
4 SASI_Hs02_00323006 predicted 1237
5 SASI_Hs02_00323007 predicted 1291
6 SASI_Hs02_00323008 predicted 1177
7 SASI_Hs02_00323009 predicted 1322
8 SASI_Hs02_00323010 predicted 2216
9 SASI_Hs02_00323011 predicted 1476
10 SASI_Hs02_00323012 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323013 predicted 2315
2 SASI_Hs02_00323014 predicted 2351
3 SASI_Hs02_00323015 predicted 1681
4 SASI_Hs02_00323016 predicted 1353
5 SASI_Hs02_00323017 predicted 1412
6 SASI_Hs02_00323018 predicted 1299
7 SASI_Hs02_00323019 predicted 1444
8 SASI_Hs02_00323020 predicted 2221
9 SASI_Hs02_00323021 predicted 1596
10 SASI_Hs02_00323022 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357606 predicted 2544
2 SASI_Hs02_00357607 predicted 2581
3 SASI_Hs02_00357608 predicted 1783
4 SASI_Hs01_00109547 predicted 1459
5 SASI_Hs02_00357609 predicted 1519
6 SASI_Hs02_00357610 predicted 1413
7 SASI_Hs02_00357611 predicted 1549
8 SASI_Hs01_00109549 predicted 2444
9 SASI_Hs02_00357612 predicted 1704
10 SASI_Hs02_00357613 predicted 748
11 SASI_Hs01_00109542 predicted 668
12 SASI_Hs01_00109543 predicted 1350
13 SASI_Hs01_00109544 predicted 2144
14 SASI_Hs01_00109545 predicted 1189
15 SASI_Hs01_00109546 predicted 640
16 SASI_Hs01_00109548 predicted 2188
17 SASI_Hs01_00109550 predicted 1946
18 SASI_Hs01_00109551 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024952
VALIDATED
C14orf159 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 159
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1787s21c1
Sequence:CCGGAGACGCAGATCCCGATATTAACTCGAGTTAATATCGGGATCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-2045s21c1
Sequence:CCGGACGAGCTTGGGATGGGTAAAGCTCGAGCTTTACCCATCCCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1698s21c1
Sequence:CCGGGGAGAAGGAGGTCGCCATAATCTCGAGATTATGGCGACCTCCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1862s21c1
Sequence:CCGGACCCGCAGACACCTAGATTTGCTCGAGCAAATCTAGGTGTCTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024952.6-2522s21c1
Sequence:CCGGGGCGACAATCCTGCTAGTAAACTCGAGTTTACTAGCAGGATTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-2291s1c1
Sequence:CCGGCGTCGGTCATTAAGGAAGAAACTCGAGTTTCTTCCTTAATGACCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024952.4-2691s1c1
Sequence:CCGGGCGTTGATTTCAACCCTCCTTCTCGAGAAGGAGGGTTGAAATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-1545s1c1
Sequence:CCGGGCTCTGTAAAGATGAGCTGCTCTCGAGAGCAGCTCATCTTTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-678s1c1
Sequence:CCGGCATCAGAAATACATCCAGCATCTCGAGATGCTGGATGTATTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024952.4-1797s1c1
Sequence:CCGGGCAGATCCCGATATTAACTTACTCGAGTAAGTTAATATCGGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_024952.4-2631s1c1
Sequence:CCGGCGTGGACAAAGGACAACATTTCTCGAGAAATGTTGTCCTTTGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024952.4-2802s1c1
Sequence:CCGGGCAGAGCATGAGAACAACATTCTCGAGAATGTTGTTCTCATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024952
VALIDATED
C14orf159 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 159
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1787s21c1
Sequence:CCGGAGACGCAGATCCCGATATTAACTCGAGTTAATATCGGGATCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-2045s21c1
Sequence:CCGGACGAGCTTGGGATGGGTAAAGCTCGAGCTTTACCCATCCCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1698s21c1
Sequence:CCGGGGAGAAGGAGGTCGCCATAATCTCGAGATTATGGCGACCTCCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1862s21c1
Sequence:CCGGACCCGCAGACACCTAGATTTGCTCGAGCAAATCTAGGTGTCTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024952.6-2522s21c1
Sequence:CCGGGGCGACAATCCTGCTAGTAAACTCGAGTTTACTAGCAGGATTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-2291s1c1
Sequence:CCGGCGTCGGTCATTAAGGAAGAAACTCGAGTTTCTTCCTTAATGACCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024952.4-2691s1c1
Sequence:CCGGGCGTTGATTTCAACCCTCCTTCTCGAGAAGGAGGGTTGAAATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-1545s1c1
Sequence:CCGGGCTCTGTAAAGATGAGCTGCTCTCGAGAGCAGCTCATCTTTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-678s1c1
Sequence:CCGGCATCAGAAATACATCCAGCATCTCGAGATGCTGGATGTATTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024952.4-1797s1c1
Sequence:CCGGGCAGATCCCGATATTAACTTACTCGAGTAAGTTAATATCGGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_024952.4-2631s1c1
Sequence:CCGGCGTGGACAAAGGACAACATTTCTCGAGAAATGTTGTCCTTTGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024952.4-2802s1c1
Sequence:CCGGGCAGAGCATGAGAACAACATTCTCGAGAATGTTGTTCTCATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024952
VALIDATED
C14orf159 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 159
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1787s21c1
Sequence:CCGGAGACGCAGATCCCGATATTAACTCGAGTTAATATCGGGATCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-2045s21c1
Sequence:CCGGACGAGCTTGGGATGGGTAAAGCTCGAGCTTTACCCATCCCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1698s21c1
Sequence:CCGGGGAGAAGGAGGTCGCCATAATCTCGAGATTATGGCGACCTCCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024952.6-1862s21c1
Sequence:CCGGACCCGCAGACACCTAGATTTGCTCGAGCAAATCTAGGTGTCTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024952.6-2522s21c1
Sequence:CCGGGGCGACAATCCTGCTAGTAAACTCGAGTTTACTAGCAGGATTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-2291s1c1
Sequence:CCGGCGTCGGTCATTAAGGAAGAAACTCGAGTTTCTTCCTTAATGACCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024952.4-2691s1c1
Sequence:CCGGGCGTTGATTTCAACCCTCCTTCTCGAGAAGGAGGGTTGAAATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-1545s1c1
Sequence:CCGGGCTCTGTAAAGATGAGCTGCTCTCGAGAGCAGCTCATCTTTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024952.4-678s1c1
Sequence:CCGGCATCAGAAATACATCCAGCATCTCGAGATGCTGGATGTATTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024952.4-1797s1c1
Sequence:CCGGGCAGATCCCGATATTAACTTACTCGAGTAAGTTAATATCGGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_024952.4-2631s1c1
Sequence:CCGGCGTGGACAAAGGACAACATTTCTCGAGAAATGTTGTCCTTTGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024952.4-2802s1c1
Sequence:CCGGGCAGAGCATGAGAACAACATTCTCGAGAATGTTGTTCTCATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks