EMAIL THIS PAGE TO A FRIEND

C14orf166

chromosome 14 open reading frame 166

28 Gene Product Result for
Synonyms: CGI99 CLE CLE7 LCRP369 RLLM1
Species: Human C14orf166(51637)
UniProtKB ID: Q9Y224
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039824 Anti-C14orf166 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV34545 Anti-C14ORF166 antibody produced in rabbit affinity isolated antibody human, mouse, horse, rat, bovine, guinea pig, rabbit, canine
western blot pricing
SAB2104416 Anti-C14ORF166 antibody produced in rabbit affinity isolated antibody zebrafish, human, canine, mouse, rabbit, rat, guinea pig, bovine, horse
western blot pricing
SAB2103002 Anti-C14ORF166, (N-terminal) antibody produced in rabbit affinity isolated antibody , human, rat, canine, bovine, mouse, zebrafish, horse, rabbit, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016039 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047521 MISSION® esiRNA esiRNA human C14orf166 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016039 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011226 predicted 379
2 SASI_Hs02_00348755 predicted 808
3 SASI_Hs01_00011227 predicted 426
4 SASI_Hs01_00011229 predicted 488
5 SASI_Hs02_00348756 predicted 552
6 SASI_Hs01_00011230 predicted 494
7 SASI_Hs02_00348757 predicted 554
8 SASI_Hs01_00011232 predicted 248
9 SASI_Hs01_00011233 predicted 522
10 SASI_Hs02_00348758 predicted 202
11 SASI_Hs01_00011228 predicted 218
12 SASI_Hs01_00011231 predicted 271
13 SASI_Hs01_00011234 predicted 777
14 SASI_Hs01_00011235 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016039
VALIDATED
C14orf166 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 166
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-921s1c1
Sequence:CCGGCCTACTTAGTACAGTTGGGAACTCGAGTTCCCAACTGTACTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-513s1c1
Sequence:CCGGGAACCATTGATCAATTTGGATCTCGAGATCCAAATTGATCAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016039.1-663s1c1
Sequence:CCGGGCAGTTGCTAAGGCAAATCAACTCGAGTTGATTTGCCTTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016039.1-457s1c1
Sequence:CCGGACAAGGATTTAGTACCTGATACTCGAGTATCAGGTACTAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-699s1c1
Sequence:CCGGCCTGTTGCTTTAGACAAACATCTCGAGATGTTTGTCTAAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016039.2-632s21c1
Sequence:CCGGGCAGTTGCTAAGGCAAATCAACTCGAGTTGATTTGCCTTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-890s21c1
Sequence:CCGGCCTACTTAGTACAGTTGGGAACTCGAGTTCCCAACTGTACTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-482s21c1
Sequence:CCGGGAACCATTGATCAATTTGGATCTCGAGATCCAAATTGATCAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-668s21c1
Sequence:CCGGCCTGTTGCTTTAGACAAACATCTCGAGATGTTTGTCTAAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016039.2-426s21c1
Sequence:CCGGACAAGGATTTAGTACCTGATACTCGAGTATCAGGTACTAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016039
VALIDATED
C14orf166 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 166
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-921s1c1
Sequence:CCGGCCTACTTAGTACAGTTGGGAACTCGAGTTCCCAACTGTACTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-513s1c1
Sequence:CCGGGAACCATTGATCAATTTGGATCTCGAGATCCAAATTGATCAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016039.1-663s1c1
Sequence:CCGGGCAGTTGCTAAGGCAAATCAACTCGAGTTGATTTGCCTTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016039.1-457s1c1
Sequence:CCGGACAAGGATTTAGTACCTGATACTCGAGTATCAGGTACTAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-699s1c1
Sequence:CCGGCCTGTTGCTTTAGACAAACATCTCGAGATGTTTGTCTAAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016039.2-632s21c1
Sequence:CCGGGCAGTTGCTAAGGCAAATCAACTCGAGTTGATTTGCCTTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-890s21c1
Sequence:CCGGCCTACTTAGTACAGTTGGGAACTCGAGTTCCCAACTGTACTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-482s21c1
Sequence:CCGGGAACCATTGATCAATTTGGATCTCGAGATCCAAATTGATCAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-668s21c1
Sequence:CCGGCCTGTTGCTTTAGACAAACATCTCGAGATGTTTGTCTAAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016039.2-426s21c1
Sequence:CCGGACAAGGATTTAGTACCTGATACTCGAGTATCAGGTACTAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016039
VALIDATED
C14orf166 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 166
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-921s1c1
Sequence:CCGGCCTACTTAGTACAGTTGGGAACTCGAGTTCCCAACTGTACTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-513s1c1
Sequence:CCGGGAACCATTGATCAATTTGGATCTCGAGATCCAAATTGATCAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016039.1-663s1c1
Sequence:CCGGGCAGTTGCTAAGGCAAATCAACTCGAGTTGATTTGCCTTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016039.1-457s1c1
Sequence:CCGGACAAGGATTTAGTACCTGATACTCGAGTATCAGGTACTAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016039.1-699s1c1
Sequence:CCGGCCTGTTGCTTTAGACAAACATCTCGAGATGTTTGTCTAAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016039.2-632s21c1
Sequence:CCGGGCAGTTGCTAAGGCAAATCAACTCGAGTTGATTTGCCTTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-890s21c1
Sequence:CCGGCCTACTTAGTACAGTTGGGAACTCGAGTTCCCAACTGTACTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-482s21c1
Sequence:CCGGGAACCATTGATCAATTTGGATCTCGAGATCCAAATTGATCAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016039.2-668s21c1
Sequence:CCGGCCTGTTGCTTTAGACAAACATCTCGAGATGTTTGTCTAAAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016039.2-426s21c1
Sequence:CCGGACAAGGATTTAGTACCTGATACTCGAGTATCAGGTACTAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks