EMAIL THIS PAGE TO A FRIEND

C14orf166B

chromosome 14 open reading frame 166B

UniProtKB ID: Q0VAA2, Q6ZUG6, Q9Y627
Gene ID:
chicken(427063) chromosome 15 open reading frame, human C14orf166B
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194287 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082681 MISSION® esiRNA esiRNA human C14orf166B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194287 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085866 predicted 1193
2 SASI_Hs01_00085868 predicted 1073
3 SASI_Hs02_00371414 predicted 706
4 SASI_Hs02_00371415 predicted 794
5 SASI_Hs02_00371416 predicted 560
6 SASI_Hs02_00371417 predicted 1327
7 SASI_Hs01_00085871 predicted 1093
8 SASI_Hs02_00371418 predicted 203
9 SASI_Hs01_00085872 predicted 610
10 SASI_Hs01_00085873 predicted 780
11 SASI_Hs01_00085867 predicted 835
12 SASI_Hs01_00085869 predicted 1025
13 SASI_Hs01_00085870 predicted 1523
14 SASI_Hs01_00085874 predicted 704
15 SASI_Hs01_00085875 predicted 1571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194287
C14orf166B MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 166B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-784s21c1
Sequence:CCGGGATCTCAGTCACAACCAATTCCTCGAGGAATTGGTTGTGACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-401s21c1
Sequence:CCGGTGCCTGTCTCCTACTTCATTCCTCGAGGAATGAAGTAGGAGACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-223s21c1
Sequence:CCGGGTACGACAGAGCAGCGATAAACTCGAGTTTATCGCTGCTCTGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194287.1-1346s1c1
Sequence:CCGGCCAGGATGGAAGAGCTTGATACTCGAGTATCAAGCTCTTCCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-754s1c1
Sequence:CCGGGCTGGAAGACAATTGCATCATCTCGAGATGATGCAATTGTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-979s1c1
Sequence:CCGGGTCGACCAATTACCAAATTAACTCGAGTTAATTTGGTAATTGGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-929s1c1
Sequence:CCGGTCAGGAAATGACTTCAAGGAACTCGAGTTCCTTGAAGTCATTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-1085s1c1
Sequence:CCGGTCACTGGATCTGAGCTGGAATCTCGAGATTCCAGCTCAGATCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194287
C14orf166B MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 166B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-784s21c1
Sequence:CCGGGATCTCAGTCACAACCAATTCCTCGAGGAATTGGTTGTGACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-401s21c1
Sequence:CCGGTGCCTGTCTCCTACTTCATTCCTCGAGGAATGAAGTAGGAGACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-223s21c1
Sequence:CCGGGTACGACAGAGCAGCGATAAACTCGAGTTTATCGCTGCTCTGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194287.1-1346s1c1
Sequence:CCGGCCAGGATGGAAGAGCTTGATACTCGAGTATCAAGCTCTTCCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-754s1c1
Sequence:CCGGGCTGGAAGACAATTGCATCATCTCGAGATGATGCAATTGTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-979s1c1
Sequence:CCGGGTCGACCAATTACCAAATTAACTCGAGTTAATTTGGTAATTGGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-929s1c1
Sequence:CCGGTCAGGAAATGACTTCAAGGAACTCGAGTTCCTTGAAGTCATTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-1085s1c1
Sequence:CCGGTCACTGGATCTGAGCTGGAATCTCGAGATTCCAGCTCAGATCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194287
C14orf166B MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 166B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-784s21c1
Sequence:CCGGGATCTCAGTCACAACCAATTCCTCGAGGAATTGGTTGTGACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-401s21c1
Sequence:CCGGTGCCTGTCTCCTACTTCATTCCTCGAGGAATGAAGTAGGAGACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194287.2-223s21c1
Sequence:CCGGGTACGACAGAGCAGCGATAAACTCGAGTTTATCGCTGCTCTGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194287.1-1346s1c1
Sequence:CCGGCCAGGATGGAAGAGCTTGATACTCGAGTATCAAGCTCTTCCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-754s1c1
Sequence:CCGGGCTGGAAGACAATTGCATCATCTCGAGATGATGCAATTGTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-979s1c1
Sequence:CCGGGTCGACCAATTACCAAATTAACTCGAGTTAATTTGGTAATTGGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-929s1c1
Sequence:CCGGTCAGGAAATGACTTCAAGGAACTCGAGTTCCTTGAAGTCATTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194287.1-1085s1c1
Sequence:CCGGTCACTGGATCTGAGCTGGAATCTCGAGATTCCAGCTCAGATCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks