EMAIL THIS PAGE TO A FRIEND

C14orf169

chromosome 14 open reading frame 169

44 Gene Product Result for
Synonyms: MAPJD NO66 ROX
Species: Human C14orf169(79697)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024644 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024644 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182192 predicted 777
2 SASI_Hs01_00182193 predicted 1582
3 SASI_Hs01_00182195 predicted 1643
4 SASI_Hs02_00357038 predicted 1815
5 SASI_Hs01_00182196 predicted 1128
6 SASI_Hs01_00182197 predicted 988
7 SASI_Hs01_00182198 predicted 842
8 SASI_Hs01_00182199 predicted 517
9 SASI_Hs01_00182200 predicted 1477
10 SASI_Hs01_00182201 predicted 1620
11 SASI_Hs01_00182194 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024644
C14orf169 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 169
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1698s1c1
Sequence:CCGGCCATATGCTTCAGGATGGGATCTCGAGATCCCATCCTGAAGCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1418s1c1
Sequence:CCGGCCCGAGACTTCATGGATTACACTCGAGTGTAATCCATGAAGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1776s1c1
Sequence:CCGGCCGTGTGTATCATCTGGAAGACTCGAGTCTTCCAGATGATACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1228s1c1
Sequence:CCGGGAACCTGGAGATTTGCTGTATCTCGAGATACAGCAAATCTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1672s1c1
Sequence:CCGGGCCCAGTTGACAACAGAAACACTCGAGTGTTTCTGTTGTCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024644.2-1138s21c1
Sequence:CCGGTAGGAAACTCTGGCGTGTATACTCGAGTATACACGCCAGAGTTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024644.2-2229s21c1
Sequence:CCGGACCCTTGATCCGTGATCATTTCTCGAGAAATGATCACGGATCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024644.2-1984s21c1
Sequence:CCGGGATGCCTCTAGCCCTAAATTACTCGAGTAATTTAGGGCTAGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024644
C14orf169 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 169
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1698s1c1
Sequence:CCGGCCATATGCTTCAGGATGGGATCTCGAGATCCCATCCTGAAGCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1418s1c1
Sequence:CCGGCCCGAGACTTCATGGATTACACTCGAGTGTAATCCATGAAGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1776s1c1
Sequence:CCGGCCGTGTGTATCATCTGGAAGACTCGAGTCTTCCAGATGATACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1228s1c1
Sequence:CCGGGAACCTGGAGATTTGCTGTATCTCGAGATACAGCAAATCTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1672s1c1
Sequence:CCGGGCCCAGTTGACAACAGAAACACTCGAGTGTTTCTGTTGTCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024644.2-1138s21c1
Sequence:CCGGTAGGAAACTCTGGCGTGTATACTCGAGTATACACGCCAGAGTTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024644.2-2229s21c1
Sequence:CCGGACCCTTGATCCGTGATCATTTCTCGAGAAATGATCACGGATCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024644.2-1984s21c1
Sequence:CCGGGATGCCTCTAGCCCTAAATTACTCGAGTAATTTAGGGCTAGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024644
C14orf169 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 169
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1698s1c1
Sequence:CCGGCCATATGCTTCAGGATGGGATCTCGAGATCCCATCCTGAAGCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1418s1c1
Sequence:CCGGCCCGAGACTTCATGGATTACACTCGAGTGTAATCCATGAAGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1776s1c1
Sequence:CCGGCCGTGTGTATCATCTGGAAGACTCGAGTCTTCCAGATGATACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1228s1c1
Sequence:CCGGGAACCTGGAGATTTGCTGTATCTCGAGATACAGCAAATCTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024644.1-1672s1c1
Sequence:CCGGGCCCAGTTGACAACAGAAACACTCGAGTGTTTCTGTTGTCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024644.2-1138s21c1
Sequence:CCGGTAGGAAACTCTGGCGTGTATACTCGAGTATACACGCCAGAGTTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024644.2-2229s21c1
Sequence:CCGGACCCTTGATCCGTGATCATTTCTCGAGAAATGATCACGGATCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024644.2-1984s21c1
Sequence:CCGGGATGCCTCTAGCCCTAAATTACTCGAGTAATTTAGGGCTAGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks