EMAIL THIS PAGE TO A FRIEND

C14orf177

chromosome 14 open reading frame 177

19 Gene Product Result for
Species: Human C14orf177(283598)
UniProtKB ID: Q52M58, Q8N7D2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182560 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143761 MISSION® esiRNA esiRNA human C14orf177 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182560 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370688 predicted 813
2 SASI_Hs01_00127305 predicted 485
3 SASI_Hs01_00127306 predicted 782
4 SASI_Hs01_00127307 predicted 698
5 SASI_Hs01_00127309 predicted 899
6 SASI_Hs01_00127310 predicted 808
7 SASI_Hs01_00127311 predicted 466
8 SASI_Hs02_00370689 predicted 767
9 SASI_Hs01_00127312 predicted 769
10 SASI_Hs01_00127313 predicted 543
11 SASI_Hs01_00127308 predicted 520
12 SASI_Hs01_00127314 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182560
C14orf177 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 177
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182560.1-618s21c1
Sequence:CCGGGGTGAGTGCTCTACCTGTTTCCTCGAGGAAACAGGTAGAGCACTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182560.1-686s21c1
Sequence:CCGGAGGGTCATGTAATCACCAAATCTCGAGATTTGGTGATTACATGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182560.1-926s21c1
Sequence:CCGGGTCCAAGCAGAGGAATCTAAGCTCGAGCTTAGATTCCTCTGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182560.1-1059s21c1
Sequence:CCGGGTCCGAACCATGCAGTAATAGCTCGAGCTATTACTGCATGGTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-473s1c1
Sequence:CCGGGCCACATAAGCAGGGAACAAACTCGAGTTTGTTCCCTGCTTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-661s1c1
Sequence:CCGGGCCAGAGACATGAAGAAACTTCTCGAGAAGTTTCTTCATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-560s1c1
Sequence:CCGGGCAGAGCCTAAGACATAACAACTCGAGTTGTTATGTCTTAGGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-657s1c1
Sequence:CCGGGAATGCCAGAGACATGAAGAACTCGAGTTCTTCATGTCTCTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182560.1-814s1c1
Sequence:CCGGGTCAGATTTCATAGATGGAAACTCGAGTTTCCATCTATGAAATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-631s1c1
Sequence:CCGGCCTGTTTCTGTACAGAAGAGACTCGAGTCTCTTCTGTACAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182560
C14orf177 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 177
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182560.1-618s21c1
Sequence:CCGGGGTGAGTGCTCTACCTGTTTCCTCGAGGAAACAGGTAGAGCACTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182560.1-686s21c1
Sequence:CCGGAGGGTCATGTAATCACCAAATCTCGAGATTTGGTGATTACATGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182560.1-926s21c1
Sequence:CCGGGTCCAAGCAGAGGAATCTAAGCTCGAGCTTAGATTCCTCTGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182560.1-1059s21c1
Sequence:CCGGGTCCGAACCATGCAGTAATAGCTCGAGCTATTACTGCATGGTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-473s1c1
Sequence:CCGGGCCACATAAGCAGGGAACAAACTCGAGTTTGTTCCCTGCTTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-661s1c1
Sequence:CCGGGCCAGAGACATGAAGAAACTTCTCGAGAAGTTTCTTCATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-560s1c1
Sequence:CCGGGCAGAGCCTAAGACATAACAACTCGAGTTGTTATGTCTTAGGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-657s1c1
Sequence:CCGGGAATGCCAGAGACATGAAGAACTCGAGTTCTTCATGTCTCTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182560.1-814s1c1
Sequence:CCGGGTCAGATTTCATAGATGGAAACTCGAGTTTCCATCTATGAAATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-631s1c1
Sequence:CCGGCCTGTTTCTGTACAGAAGAGACTCGAGTCTCTTCTGTACAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182560
C14orf177 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 177
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182560.1-618s21c1
Sequence:CCGGGGTGAGTGCTCTACCTGTTTCCTCGAGGAAACAGGTAGAGCACTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182560.1-686s21c1
Sequence:CCGGAGGGTCATGTAATCACCAAATCTCGAGATTTGGTGATTACATGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182560.1-926s21c1
Sequence:CCGGGTCCAAGCAGAGGAATCTAAGCTCGAGCTTAGATTCCTCTGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182560.1-1059s21c1
Sequence:CCGGGTCCGAACCATGCAGTAATAGCTCGAGCTATTACTGCATGGTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-473s1c1
Sequence:CCGGGCCACATAAGCAGGGAACAAACTCGAGTTTGTTCCCTGCTTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-661s1c1
Sequence:CCGGGCCAGAGACATGAAGAAACTTCTCGAGAAGTTTCTTCATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-560s1c1
Sequence:CCGGGCAGAGCCTAAGACATAACAACTCGAGTTGTTATGTCTTAGGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-657s1c1
Sequence:CCGGGAATGCCAGAGACATGAAGAACTCGAGTTCTTCATGTCTCTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182560.1-814s1c1
Sequence:CCGGGTCAGATTTCATAGATGGAAACTCGAGTTTCCATCTATGAAATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182560.1-631s1c1
Sequence:CCGGCCTGTTTCTGTACAGAAGAGACTCGAGTCTCTTCTGTACAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks