EMAIL THIS PAGE TO A FRIEND

C14orf178

chromosome 14 open reading frame 178

52 Gene Product Result for
Species: Human C14orf178(283579)
UniProtKB ID: Q8N769, Q2HIX2, Q3KNR7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174943 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185742 predicted 479
2 SASI_Hs01_00185743 predicted 486
3 SASI_Hs01_00185744 predicted 483
4 SASI_Hs01_00185745 predicted 680
5 SASI_Hs01_00185746 predicted 465
6 SASI_Hs01_00185747 predicted 671
7 SASI_Hs01_00185748 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174943
C14orf178 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 178
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-660s1c1
Sequence:CCGGCCCGGAGAACATGATCTTAACCTCGAGGTTAAGATCATGTTCTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-659s1c1
Sequence:CCGGGCCCGGAGAACATGATCTTAACTCGAGTTAAGATCATGTTCTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-728s1c1
Sequence:CCGGGTCAGACAGACCTGAGTTCAACTCGAGTTGAACTCAGGTCTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-680s1c1
Sequence:CCGGCCATACTGTCTTCCAAGTGAACTCGAGTTCACTTGGAAGACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-692s1c1
Sequence:CCGGCCAAGTGAAAGATTCTACCTTCTCGAGAAGGTAGAATCTTTCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-664s1c1
Sequence:CCGGGAGAACATGATCTTAACCATACTCGAGTATGGTTAAGATCATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-689s1c1
Sequence:CCGGCTTCCAAGTGAAAGATTCTACCTCGAGGTAGAATCTTTCACTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-675s1c1
Sequence:CCGGCTTAACCATACTGTCTTCCAACTCGAGTTGGAAGACAGTATGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174943.2-714s21c1
Sequence:CCGGCTAAGACATCTGGAGTCAGACCTCGAGGTCTGACTCCAGATGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174943
C14orf178 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 178
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-660s1c1
Sequence:CCGGCCCGGAGAACATGATCTTAACCTCGAGGTTAAGATCATGTTCTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-659s1c1
Sequence:CCGGGCCCGGAGAACATGATCTTAACTCGAGTTAAGATCATGTTCTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-728s1c1
Sequence:CCGGGTCAGACAGACCTGAGTTCAACTCGAGTTGAACTCAGGTCTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-680s1c1
Sequence:CCGGCCATACTGTCTTCCAAGTGAACTCGAGTTCACTTGGAAGACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-692s1c1
Sequence:CCGGCCAAGTGAAAGATTCTACCTTCTCGAGAAGGTAGAATCTTTCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-664s1c1
Sequence:CCGGGAGAACATGATCTTAACCATACTCGAGTATGGTTAAGATCATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-689s1c1
Sequence:CCGGCTTCCAAGTGAAAGATTCTACCTCGAGGTAGAATCTTTCACTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-675s1c1
Sequence:CCGGCTTAACCATACTGTCTTCCAACTCGAGTTGGAAGACAGTATGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174943.2-714s21c1
Sequence:CCGGCTAAGACATCTGGAGTCAGACCTCGAGGTCTGACTCCAGATGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174943
C14orf178 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 178
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-660s1c1
Sequence:CCGGCCCGGAGAACATGATCTTAACCTCGAGGTTAAGATCATGTTCTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-659s1c1
Sequence:CCGGGCCCGGAGAACATGATCTTAACTCGAGTTAAGATCATGTTCTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-728s1c1
Sequence:CCGGGTCAGACAGACCTGAGTTCAACTCGAGTTGAACTCAGGTCTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-680s1c1
Sequence:CCGGCCATACTGTCTTCCAAGTGAACTCGAGTTCACTTGGAAGACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-692s1c1
Sequence:CCGGCCAAGTGAAAGATTCTACCTTCTCGAGAAGGTAGAATCTTTCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-664s1c1
Sequence:CCGGGAGAACATGATCTTAACCATACTCGAGTATGGTTAAGATCATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-689s1c1
Sequence:CCGGCTTCCAAGTGAAAGATTCTACCTCGAGGTAGAATCTTTCACTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174943.2-675s1c1
Sequence:CCGGCTTAACCATACTGTCTTCCAACTCGAGTTGGAAGACAGTATGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174943.2-714s21c1
Sequence:CCGGCTAAGACATCTGGAGTCAGACCTCGAGGTCTGACTCCAGATGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks