EMAIL THIS PAGE TO A FRIEND

C14orf180

chromosome 14 open reading frame 180

21 Gene Product Result for
Synonyms: C14orf77 NRAC
Species: Human C14orf180(400258)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375108 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127061 MISSION® esiRNA esiRNA human C14orf180 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008404 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058481 predicted 1035
2 SASI_Hs01_00058487 predicted 1265
3 SASI_Hs01_00058482 predicted 1041
4 SASI_Hs01_00058483 predicted 1005
5 SASI_Hs01_00058484 predicted 336
6 SASI_Hs01_00058485 predicted 1136
7 SASI_Hs01_00058486 predicted 1041
8 SASI_Hs01_00058488 predicted 1169
9 SASI_Hs01_00058489 predicted 1783
10 SASI_Hs01_00058490 predicted 1776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008404
C14orf180 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 180
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-537s21c1
Sequence:CCGGTCCACTACATTGCTGACAAGACTCGAGTCTTGTCAGCAATGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-406s21c1
Sequence:CCGGAGAGAGGGAGGACAACAGGAACTCGAGTTCCTGTTGTCCTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-347s21c1
Sequence:CCGGACACGACGTCAGACCAGAAAGCTCGAGCTTTCTGGTCTGACGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008404.1-1012s21c1
Sequence:CCGGTGTTGGGTCCATGTGAGATTTCTCGAGAAATCTCACATGGACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-526s21c1
Sequence:CCGGAGCGGTGACCGTCCACTACATCTCGAGATGTAGTGGACGGTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008404
C14orf180 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 180
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-537s21c1
Sequence:CCGGTCCACTACATTGCTGACAAGACTCGAGTCTTGTCAGCAATGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-406s21c1
Sequence:CCGGAGAGAGGGAGGACAACAGGAACTCGAGTTCCTGTTGTCCTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-347s21c1
Sequence:CCGGACACGACGTCAGACCAGAAAGCTCGAGCTTTCTGGTCTGACGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008404.1-1012s21c1
Sequence:CCGGTGTTGGGTCCATGTGAGATTTCTCGAGAAATCTCACATGGACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-526s21c1
Sequence:CCGGAGCGGTGACCGTCCACTACATCTCGAGATGTAGTGGACGGTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008404
C14orf180 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 180
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-537s21c1
Sequence:CCGGTCCACTACATTGCTGACAAGACTCGAGTCTTGTCAGCAATGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-406s21c1
Sequence:CCGGAGAGAGGGAGGACAACAGGAACTCGAGTTCCTGTTGTCCTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-347s21c1
Sequence:CCGGACACGACGTCAGACCAGAAAGCTCGAGCTTTCTGGTCTGACGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008404.1-1012s21c1
Sequence:CCGGTGTTGGGTCCATGTGAGATTTCTCGAGAAATCTCACATGGACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008404.1-526s21c1
Sequence:CCGGAGCGGTGACCGTCCACTACATCTCGAGATGTAGTGGACGGTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375108
C14orf180 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 180
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375108.1-550s1c1
Sequence:CCGGCGACGTCAGACCAGAAAGAATCTCGAGATTCTTTCTGGTCTGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375108.1-1238s1c1
Sequence:CCGGGAAAGAGGATTCGACTGCTAACTCGAGTTAGCAGTCGAATCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375108.1-738s1c1
Sequence:CCGGCCACTACATTGCTGACAAGAACTCGAGTTCTTGTCAGCAATGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375108
C14orf180 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 180
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375108.1-550s1c1
Sequence:CCGGCGACGTCAGACCAGAAAGAATCTCGAGATTCTTTCTGGTCTGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375108.1-1238s1c1
Sequence:CCGGGAAAGAGGATTCGACTGCTAACTCGAGTTAGCAGTCGAATCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375108.1-738s1c1
Sequence:CCGGCCACTACATTGCTGACAAGAACTCGAGTTCTTGTCAGCAATGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375108
C14orf180 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 180
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375108.1-550s1c1
Sequence:CCGGCGACGTCAGACCAGAAAGAATCTCGAGATTCTTTCTGGTCTGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375108.1-1238s1c1
Sequence:CCGGGAAAGAGGATTCGACTGCTAACTCGAGTTAGCAGTCGAATCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375108.1-738s1c1
Sequence:CCGGCCACTACATTGCTGACAAGAACTCGAGTTCTTGTCAGCAATGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks