EMAIL THIS PAGE TO A FRIEND

C14orf182

chromosome 14 open reading frame 182

17 Gene Product Result for
Species: Human C14orf182(283551)
UniProtKB ID: A1A4T8, A8MYX4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012706 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105731 MISSION® esiRNA esiRNA human AL117692.5-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202738 predicted 1750
2 SASI_Hs01_00202739 predicted 1727
3 SASI_Hs01_00202740 predicted 1799
4 SASI_Hs01_00202741 predicted 1721
5 SASI_Hs01_00202743 predicted 1797
6 SASI_Hs01_00202744 predicted 1748
7 SASI_Hs01_00202745 predicted 1786
8 SASI_Hs01_00202746 predicted 1790
9 SASI_Hs01_00202737 predicted 1811
10 SASI_Hs02_00306214 predicted 1847
11 SASI_Hs01_00202742 predicted 1817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012706
C14orf182 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 182
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012706.1-1837s1c1
Sequence:CCGGGAGGTCTTTCAAGATCACACACTCGAGTGTGTGATCTTGAAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167075    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012706.1-2289s1c1
Sequence:CCGGCTTTGCCAGATAATTCTGATTCTCGAGAATCAGAATTATCTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-2032s21c1
Sequence:CCGGTGCAGAGTGTATGACACATAACTCGAGTTATGTGTCATACACTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1865s21c1
Sequence:CCGGACGACACAGACATTTCGTCTTCTCGAGAAGACGAAATGTCTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1826s21c1
Sequence:CCGGTCACGAACCGAGAGGTCTTTCCTCGAGGAAAGACCTCTCGGTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1801s21c1
Sequence:CCGGAGCCTGACAGAACCCAAGATGCTCGAGCATCTTGGGTTCTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012706.1-2064s21c1
Sequence:CCGGGAAATGTCTACCGAGGAATTACTCGAGTAATTCCTCGGTAGACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012706
C14orf182 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 182
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012706.1-1837s1c1
Sequence:CCGGGAGGTCTTTCAAGATCACACACTCGAGTGTGTGATCTTGAAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167075    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012706.1-2289s1c1
Sequence:CCGGCTTTGCCAGATAATTCTGATTCTCGAGAATCAGAATTATCTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-2032s21c1
Sequence:CCGGTGCAGAGTGTATGACACATAACTCGAGTTATGTGTCATACACTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1865s21c1
Sequence:CCGGACGACACAGACATTTCGTCTTCTCGAGAAGACGAAATGTCTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1826s21c1
Sequence:CCGGTCACGAACCGAGAGGTCTTTCCTCGAGGAAAGACCTCTCGGTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1801s21c1
Sequence:CCGGAGCCTGACAGAACCCAAGATGCTCGAGCATCTTGGGTTCTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012706.1-2064s21c1
Sequence:CCGGGAAATGTCTACCGAGGAATTACTCGAGTAATTCCTCGGTAGACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012706
C14orf182 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 182
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012706.1-1837s1c1
Sequence:CCGGGAGGTCTTTCAAGATCACACACTCGAGTGTGTGATCTTGAAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167075    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012706.1-2289s1c1
Sequence:CCGGCTTTGCCAGATAATTCTGATTCTCGAGAATCAGAATTATCTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-2032s21c1
Sequence:CCGGTGCAGAGTGTATGACACATAACTCGAGTTATGTGTCATACACTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1865s21c1
Sequence:CCGGACGACACAGACATTTCGTCTTCTCGAGAAGACGAAATGTCTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1826s21c1
Sequence:CCGGTCACGAACCGAGAGGTCTTTCCTCGAGGAAAGACCTCTCGGTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012706.1-1801s21c1
Sequence:CCGGAGCCTGACAGAACCCAAGATGCTCGAGCATCTTGGGTTCTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012706.1-2064s21c1
Sequence:CCGGGAAATGTCTACCGAGGAATTACTCGAGTAATTCCTCGGTAGACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks