EMAIL THIS PAGE TO A FRIEND

C14orf183

chromosome 14 open reading frame 183

16 Gene Product Result for
Species: Human C14orf183(196913)
UniProtKB ID: Q8WXQ3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014830 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014830 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013830 predicted 640
2 SASI_Hs01_00013831 predicted 746
3 SASI_Hs01_00013832 predicted 710
4 SASI_Hs02_00306577 predicted 34
5 SASI_Hs02_00306578 predicted 552
6 SASI_Hs01_00013834 predicted 823
7 SASI_Hs01_00013835 predicted 327
8 SASI_Hs01_00013837 predicted 184
9 SASI_Hs01_00013838 predicted 574
10 SASI_Hs01_00013839 predicted 626
11 SASI_Hs01_00013833 predicted 639
12 SASI_Hs01_00013836 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014830
C14orf183 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 183
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014830.1-354s1c1
Sequence:CCGGGATACTCAGGAATCCCTGGTTCTCGAGAACCAGGGATTCCTGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-52s1c1
Sequence:CCGGCAACTTGAAATCTGGATGGAACTCGAGTTCCATCCAGATTTCAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-531s1c1
Sequence:CCGGCTGGATCCCATTGTTTACAATCTCGAGATTGTAAACAATGGGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-543s1c1
Sequence:CCGGGTTTACAATGTGGTCTTGGCTCTCGAGAGCCAAGACCACATTGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-255s1c1
Sequence:CCGGCACTTCATGTCTTCAGAGCATCTCGAGATGCTCTGAAGACATGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014830.1-436s1c1
Sequence:CCGGCCTGGTTTGCAGTTCTTCATTCTCGAGAATGAAGAACTGCAAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-41s1c1
Sequence:CCGGGAGCCAAACGTCAACTTGAAACTCGAGTTTCAAGTTGACGTTTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014830
C14orf183 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 183
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014830.1-354s1c1
Sequence:CCGGGATACTCAGGAATCCCTGGTTCTCGAGAACCAGGGATTCCTGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-52s1c1
Sequence:CCGGCAACTTGAAATCTGGATGGAACTCGAGTTCCATCCAGATTTCAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-531s1c1
Sequence:CCGGCTGGATCCCATTGTTTACAATCTCGAGATTGTAAACAATGGGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-543s1c1
Sequence:CCGGGTTTACAATGTGGTCTTGGCTCTCGAGAGCCAAGACCACATTGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-255s1c1
Sequence:CCGGCACTTCATGTCTTCAGAGCATCTCGAGATGCTCTGAAGACATGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014830.1-436s1c1
Sequence:CCGGCCTGGTTTGCAGTTCTTCATTCTCGAGAATGAAGAACTGCAAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-41s1c1
Sequence:CCGGGAGCCAAACGTCAACTTGAAACTCGAGTTTCAAGTTGACGTTTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014830
C14orf183 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 183
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014830.1-354s1c1
Sequence:CCGGGATACTCAGGAATCCCTGGTTCTCGAGAACCAGGGATTCCTGAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-52s1c1
Sequence:CCGGCAACTTGAAATCTGGATGGAACTCGAGTTCCATCCAGATTTCAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-531s1c1
Sequence:CCGGCTGGATCCCATTGTTTACAATCTCGAGATTGTAAACAATGGGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-543s1c1
Sequence:CCGGGTTTACAATGTGGTCTTGGCTCTCGAGAGCCAAGACCACATTGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-255s1c1
Sequence:CCGGCACTTCATGTCTTCAGAGCATCTCGAGATGCTCTGAAGACATGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014830.1-436s1c1
Sequence:CCGGCCTGGTTTGCAGTTCTTCATTCTCGAGAATGAAGAACTGCAAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014830.1-41s1c1
Sequence:CCGGGAGCCAAACGTCAACTTGAAACTCGAGTTTCAAGTTGACGTTTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)