EMAIL THIS PAGE TO A FRIEND

C14orf1

chromosome 14 open reading frame 1

61 Gene Product Result for
Synonyms: ERG28 NET51
UniProtKB ID: Q9UKR5, Q9P093, Q9UPI2
Gene ID:
chicken(423366) chromosome 5 open reading frame, human C14orf1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007176 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012981 MISSION® esiRNA esiRNA targeting human C14orf1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007176 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143837 predicted 287
2 SASI_Hs01_00143843 predicted 266
3 SASI_Hs01_00143839 predicted 262
4 SASI_Hs01_00143840 predicted 137
5 SASI_Hs01_00143841 predicted 843
6 SASI_Hs01_00143842 predicted 852
7 SASI_Hs01_00143844 predicted 351
8 SASI_Hs02_00343128 predicted 482
9 SASI_Hs01_00143845 predicted 543
10 SASI_Hs01_00143846 predicted 444
11 SASI_Hs01_00143838 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007176
VALIDATED
C14orf1 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007176.1-270s1c1
Sequence:CCGGCTGTGCCATTGACATTCACAACTCGAGTTGTGAATGTCAATGGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-288s1c1
Sequence:CCGGCAACAAGACGCTCTATCACATCTCGAGATGTGATAGAGCGTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-282s1c1
Sequence:CCGGCATTCACAACAAGACGCTCTACTCGAGTAGAGCGTCTTGTTGTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-275s1c1
Sequence:CCGGCCATTGACATTCACAACAAGACTCGAGTCTTGTTGTGAATGTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-346s1c1
Sequence:CCGGCTCTCTGAGTTGTTTGTCTATCTCGAGATAGACAAACAACTCAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007176.1-1398s1c1
Sequence:CCGGGCCCTTTCTTATTTCCTCCTACTCGAGTAGGAGGAAATAAGAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-346s21c1
Sequence:CCGGCTCTCTGAGTTGTTTGTCTATCTCGAGATAGACAAACAACTCAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-552s21c1
Sequence:CCGGTTCGTCGTCTCTCCTCTTTAACTCGAGTTAAAGAGGAGAGACGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-107s21c1
Sequence:CCGGTGGTTATGGTGTCCATCATAGCTCGAGCTATGATGGACACCATAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-487s21c1
Sequence:CCGGAGAAACTGAGGCCAGCATTATCTCGAGATAATGCTGGCCTCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-282s21c1
Sequence:CCGGCATTCACAACAAGACGCTCTACTCGAGTAGAGCGTCTTGTTGTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007176
VALIDATED
C14orf1 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007176.1-270s1c1
Sequence:CCGGCTGTGCCATTGACATTCACAACTCGAGTTGTGAATGTCAATGGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-288s1c1
Sequence:CCGGCAACAAGACGCTCTATCACATCTCGAGATGTGATAGAGCGTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-282s1c1
Sequence:CCGGCATTCACAACAAGACGCTCTACTCGAGTAGAGCGTCTTGTTGTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-275s1c1
Sequence:CCGGCCATTGACATTCACAACAAGACTCGAGTCTTGTTGTGAATGTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-346s1c1
Sequence:CCGGCTCTCTGAGTTGTTTGTCTATCTCGAGATAGACAAACAACTCAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007176.1-1398s1c1
Sequence:CCGGGCCCTTTCTTATTTCCTCCTACTCGAGTAGGAGGAAATAAGAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-346s21c1
Sequence:CCGGCTCTCTGAGTTGTTTGTCTATCTCGAGATAGACAAACAACTCAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-552s21c1
Sequence:CCGGTTCGTCGTCTCTCCTCTTTAACTCGAGTTAAAGAGGAGAGACGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-107s21c1
Sequence:CCGGTGGTTATGGTGTCCATCATAGCTCGAGCTATGATGGACACCATAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-487s21c1
Sequence:CCGGAGAAACTGAGGCCAGCATTATCTCGAGATAATGCTGGCCTCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-282s21c1
Sequence:CCGGCATTCACAACAAGACGCTCTACTCGAGTAGAGCGTCTTGTTGTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007176
VALIDATED
C14orf1 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007176.1-270s1c1
Sequence:CCGGCTGTGCCATTGACATTCACAACTCGAGTTGTGAATGTCAATGGCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-288s1c1
Sequence:CCGGCAACAAGACGCTCTATCACATCTCGAGATGTGATAGAGCGTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-282s1c1
Sequence:CCGGCATTCACAACAAGACGCTCTACTCGAGTAGAGCGTCTTGTTGTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-275s1c1
Sequence:CCGGCCATTGACATTCACAACAAGACTCGAGTCTTGTTGTGAATGTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007176.1-346s1c1
Sequence:CCGGCTCTCTGAGTTGTTTGTCTATCTCGAGATAGACAAACAACTCAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007176.1-1398s1c1
Sequence:CCGGGCCCTTTCTTATTTCCTCCTACTCGAGTAGGAGGAAATAAGAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-346s21c1
Sequence:CCGGCTCTCTGAGTTGTTTGTCTATCTCGAGATAGACAAACAACTCAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-552s21c1
Sequence:CCGGTTCGTCGTCTCTCCTCTTTAACTCGAGTTAAAGAGGAGAGACGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-107s21c1
Sequence:CCGGTGGTTATGGTGTCCATCATAGCTCGAGCTATGATGGACACCATAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-487s21c1
Sequence:CCGGAGAAACTGAGGCCAGCATTATCTCGAGATAATGCTGGCCTCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007176.1-282s21c1
Sequence:CCGGCATTCACAACAAGACGCTCTACTCGAGTAGAGCGTCTTGTTGTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)