EMAIL THIS PAGE TO A FRIEND

C14orf28

chromosome 14 open reading frame 28

83 Gene Product Result for
Synonyms: DRIP-1 DRIP1 c14_5270
Species: Human C14orf28(122525)
UniProtKB ID: Q4W4Y0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059635 Anti-C14orf28 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2106944 Anti-C14ORF28 antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017923 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039771 MISSION® esiRNA esiRNA human C14orf28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017923 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236691 predicted 974
2 SASI_Hs01_00236692 predicted 792
3 SASI_Hs01_00236693 predicted 1044
4 SASI_Hs01_00236694 predicted 655
5 SASI_Hs02_00306807 predicted 569
6 SASI_Hs01_00236696 predicted 949
7 SASI_Hs01_00236697 predicted 988
8 SASI_Hs01_00236699 predicted 393
9 SASI_Hs01_00236700 predicted 434
10 SASI_Hs02_00306808 predicted 1085
11 SASI_Hs01_00236695 predicted 1018
12 SASI_Hs01_00236698 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017923
C14orf28 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 28
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017923.1-444s21c1
Sequence:CCGGGATGGATTCTTGATGTTATTACTCGAGTAATAACATCAAGAATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017923.1-2062s1c1
Sequence:CCGGCGTGCCTGGAAATACTTCTTTCTCGAGAAAGAAGTATTTCCAGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017923.1-614s1c1
Sequence:CCGGGCAATACAAATCTGAAGTCCACTCGAGTGGACTTCAGATTTGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017923.1-659s1c1
Sequence:CCGGGTTTGGGAATGAGCATGATAACTCGAGTTATCATGCTCATTCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017923.1-2511s1c1
Sequence:CCGGGCCTCACGTTAGCAAATACTACTCGAGTAGTATTTGCTAACGTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017923
C14orf28 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 28
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017923.1-444s21c1
Sequence:CCGGGATGGATTCTTGATGTTATTACTCGAGTAATAACATCAAGAATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017923.1-2062s1c1
Sequence:CCGGCGTGCCTGGAAATACTTCTTTCTCGAGAAAGAAGTATTTCCAGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017923.1-614s1c1
Sequence:CCGGGCAATACAAATCTGAAGTCCACTCGAGTGGACTTCAGATTTGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017923.1-659s1c1
Sequence:CCGGGTTTGGGAATGAGCATGATAACTCGAGTTATCATGCTCATTCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017923.1-2511s1c1
Sequence:CCGGGCCTCACGTTAGCAAATACTACTCGAGTAGTATTTGCTAACGTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017923
C14orf28 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 28
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017923.1-444s21c1
Sequence:CCGGGATGGATTCTTGATGTTATTACTCGAGTAATAACATCAAGAATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017923.1-2062s1c1
Sequence:CCGGCGTGCCTGGAAATACTTCTTTCTCGAGAAAGAAGTATTTCCAGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017923.1-614s1c1
Sequence:CCGGGCAATACAAATCTGAAGTCCACTCGAGTGGACTTCAGATTTGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017923.1-659s1c1
Sequence:CCGGGTTTGGGAATGAGCATGATAACTCGAGTTATCATGCTCATTCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017923.1-2511s1c1
Sequence:CCGGGCCTCACGTTAGCAAATACTACTCGAGTAGTATTTGCTAACGTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)