EMAIL THIS PAGE TO A FRIEND

C14orf2

chromosome 14 open reading frame 2

48 Gene Product Result for
Synonyms: MP68 PLPM
Species: Human C14orf2(9556)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144611 MISSION® esiRNA esiRNA human C14orf2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127393 Rosetta Predictions human pricing
NM_004894 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329404 predicted 630
2 SASI_Hs02_00329405 predicted 681
3 SASI_Hs02_00329406 predicted 629
4 SASI_Hs02_00329407 predicted 617
5 SASI_Hs02_00329408 predicted 569
6 SASI_Hs02_00329409 predicted 577
7 SASI_Hs02_00329410 predicted 629
8 SASI_Hs02_00329411 predicted 631
9 SASI_Hs02_00329412 predicted 688
10 SASI_Hs02_00329413 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198149 predicted 369
2 SASI_Hs01_00198152 predicted 409
3 SASI_Hs02_00338532 predicted 367
4 SASI_Hs02_00338533 predicted 347
5 SASI_Hs02_00338534 predicted 297
6 SASI_Hs02_00338535 predicted 300
7 SASI_Hs01_00198148 predicted 363
8 SASI_Hs02_00338536 predicted 353
9 SASI_Hs02_00338537 predicted 416
10 SASI_Hs02_00338538 predicted 299
11 SASI_Hs01_00198147 predicted 321
12 SASI_Hs01_00198150 predicted 397
13 SASI_Hs01_00198151 predicted 319
14 SASI_Hs01_00198153 predicted 312
15 SASI_Hs01_00198154 predicted 373
16 SASI_Hs01_00198155 predicted 396
17 SASI_Hs01_00198156 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004894
C14orf2 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004894.1-440s1c1
Sequence:CCGGCAGGCATACTCTGAGTAGATACTCGAGTATCTACTCAGAGTATGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004894.1-96s1c1
Sequence:CCGGCATGAAGCCCTACTACACCAACTCGAGTTGGTGTAGTAGGGCTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-99s1c1
Sequence:CCGGGAAGCCCTACTACACCAAAGTCTCGAGACTTTGGTGTAGTAGGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-105s1c1
Sequence:CCGGCTACTACACCAAAGTTTACCACTCGAGTGGTAAACTTTGGTGTAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004894.1-373s1c1
Sequence:CCGGGATCTGTGAGATGCACTGCTACTCGAGTAGCAGTGCATCTCACAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-113s1c1
Sequence:CCGGCCAAAGTTTACCAGGAGATTTCTCGAGAAATCTCCTGGTAAACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004894.2-264s21c1
Sequence:CCGGGTCATCACTAACCAGATTTACCTCGAGGTAAATCTGGTTAGTGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-306s21c1
Sequence:CCGGACGTCAGTCTGCCTGTAAATTCTCGAGAATTTACAGGCAGACTGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-397s21c1
Sequence:CCGGGCATGAATAAATGGATCTGTGCTCGAGCACAGATCCATTTATTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-424s21c1
Sequence:CCGGACTGCTACCTGGTACTGCTTTCTCGAGAAAGCAGTACCAGGTAGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-358s21c1
Sequence:CCGGACGTCACTGTACACTTGTATACTCGAGTATACAAGTGTACAGTGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-370s21c1
Sequence:CCGGACTTGTATAAGTACCGTTTACCTCGAGGTAAACGGTACTTATACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-500s21c1
Sequence:CCGGTTGTCATGCAGCGCATGCAATCTCGAGATTGCATGCGCTGCATGACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004894.2-186s21c1
Sequence:CCGGTGATGGGCTTCATCGTTTATACTCGAGTATAAACGATGAAGCCCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004894
C14orf2 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004894.1-440s1c1
Sequence:CCGGCAGGCATACTCTGAGTAGATACTCGAGTATCTACTCAGAGTATGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004894.1-96s1c1
Sequence:CCGGCATGAAGCCCTACTACACCAACTCGAGTTGGTGTAGTAGGGCTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-99s1c1
Sequence:CCGGGAAGCCCTACTACACCAAAGTCTCGAGACTTTGGTGTAGTAGGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-105s1c1
Sequence:CCGGCTACTACACCAAAGTTTACCACTCGAGTGGTAAACTTTGGTGTAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004894.1-373s1c1
Sequence:CCGGGATCTGTGAGATGCACTGCTACTCGAGTAGCAGTGCATCTCACAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-113s1c1
Sequence:CCGGCCAAAGTTTACCAGGAGATTTCTCGAGAAATCTCCTGGTAAACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004894.2-264s21c1
Sequence:CCGGGTCATCACTAACCAGATTTACCTCGAGGTAAATCTGGTTAGTGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-306s21c1
Sequence:CCGGACGTCAGTCTGCCTGTAAATTCTCGAGAATTTACAGGCAGACTGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-397s21c1
Sequence:CCGGGCATGAATAAATGGATCTGTGCTCGAGCACAGATCCATTTATTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-424s21c1
Sequence:CCGGACTGCTACCTGGTACTGCTTTCTCGAGAAAGCAGTACCAGGTAGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-358s21c1
Sequence:CCGGACGTCACTGTACACTTGTATACTCGAGTATACAAGTGTACAGTGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-370s21c1
Sequence:CCGGACTTGTATAAGTACCGTTTACCTCGAGGTAAACGGTACTTATACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-500s21c1
Sequence:CCGGTTGTCATGCAGCGCATGCAATCTCGAGATTGCATGCGCTGCATGACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004894.2-186s21c1
Sequence:CCGGTGATGGGCTTCATCGTTTATACTCGAGTATAAACGATGAAGCCCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004894
C14orf2 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004894.1-440s1c1
Sequence:CCGGCAGGCATACTCTGAGTAGATACTCGAGTATCTACTCAGAGTATGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004894.1-96s1c1
Sequence:CCGGCATGAAGCCCTACTACACCAACTCGAGTTGGTGTAGTAGGGCTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-99s1c1
Sequence:CCGGGAAGCCCTACTACACCAAAGTCTCGAGACTTTGGTGTAGTAGGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-105s1c1
Sequence:CCGGCTACTACACCAAAGTTTACCACTCGAGTGGTAAACTTTGGTGTAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004894.1-373s1c1
Sequence:CCGGGATCTGTGAGATGCACTGCTACTCGAGTAGCAGTGCATCTCACAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004894.1-113s1c1
Sequence:CCGGCCAAAGTTTACCAGGAGATTTCTCGAGAAATCTCCTGGTAAACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004894.2-264s21c1
Sequence:CCGGGTCATCACTAACCAGATTTACCTCGAGGTAAATCTGGTTAGTGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-306s21c1
Sequence:CCGGACGTCAGTCTGCCTGTAAATTCTCGAGAATTTACAGGCAGACTGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-397s21c1
Sequence:CCGGGCATGAATAAATGGATCTGTGCTCGAGCACAGATCCATTTATTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-424s21c1
Sequence:CCGGACTGCTACCTGGTACTGCTTTCTCGAGAAAGCAGTACCAGGTAGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-358s21c1
Sequence:CCGGACGTCACTGTACACTTGTATACTCGAGTATACAAGTGTACAGTGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-370s21c1
Sequence:CCGGACTTGTATAAGTACCGTTTACCTCGAGGTAAACGGTACTTATACAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004894.2-500s21c1
Sequence:CCGGTTGTCATGCAGCGCATGCAATCTCGAGATTGCATGCGCTGCATGACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004894.2-186s21c1
Sequence:CCGGTGATGGGCTTCATCGTTTATACTCGAGTATAAACGATGAAGCCCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)