EMAIL THIS PAGE TO A FRIEND

C14orf37

chromosome 14 open reading frame 37

88 Gene Product Result for
Synonyms: c14_5376
Species: Human C14orf37(145407)
UniProtKB ID: Q86TY3, A8K8Z8, Q6P5Q1, Q86TY1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001872 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065031 MISSION® esiRNA esiRNA human C14orf37 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001872 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126164 predicted 667
2 SASI_Hs01_00126165 predicted 499
3 SASI_Hs01_00126166 predicted 594
4 SASI_Hs01_00126167 predicted 610
5 SASI_Hs01_00126168 predicted 729
6 SASI_Hs01_00126169 predicted 1520
7 SASI_Hs01_00126171 predicted 1664
8 SASI_Hs01_00126172 predicted 921
9 SASI_Hs01_00126173 predicted 207
10 SASI_Hs02_00303964 predicted 1264
11 SASI_Hs01_00126170 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001872
C14orf37 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 37
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-713s1c1
Sequence:CCGGGAAGATGAAGAAGAGGAAGATCTCGAGATCTTCCTCTTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-695s1c1
Sequence:CCGGGAAGAGGATGAAGAAGATGAACTCGAGTTCATCTTCTTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-600s1c1
Sequence:CCGGGAAGAACTGTTGTTCCATCTACTCGAGTAGATGGAACAACAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-686s1c1
Sequence:CCGGGATGAGGATGAAGAGGATGAACTCGAGTTCATCCTCTTCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-626s1c1
Sequence:CCGGCGTGTTAATACAGCTGCCTCACTCGAGTGAGGCAGCTGTATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-1063s1c1
Sequence:CCGGCCGAAGGAGAAATGGCTTCAACTCGAGTTGAAGCCATTTCTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-587s1c1
Sequence:CCGGGCATCCTCTGAGAGAAGAACTCTCGAGAGTTCTTCTCTCAGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-722s1c1
Sequence:CCGGGAAGAGGAAGATGAGGAAGAACTCGAGTTCTTCCTCATCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-731s1c1
Sequence:CCGGGATGAGGAAGAAGATGAGGAACTCGAGTTCCTCATCTTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-665s1c1
Sequence:CCGGGAATCTGAAGAGGGACAAGAACTCGAGTTCTTGTCCCTCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-1064s1c1
Sequence:CCGGCGAAGGAGAAATGGCTTCAAACTCGAGTTTGAAGCCATTTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-905s1c1
Sequence:CCGGGAGTGGGAACAGCAGAATCAACTCGAGTTGATTCTGCTGTTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-614s1c1
Sequence:CCGGCCATCTATTACTCGTGTTAATCTCGAGATTAACACGAGTAATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001872
C14orf37 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 37
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-713s1c1
Sequence:CCGGGAAGATGAAGAAGAGGAAGATCTCGAGATCTTCCTCTTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-695s1c1
Sequence:CCGGGAAGAGGATGAAGAAGATGAACTCGAGTTCATCTTCTTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-600s1c1
Sequence:CCGGGAAGAACTGTTGTTCCATCTACTCGAGTAGATGGAACAACAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-686s1c1
Sequence:CCGGGATGAGGATGAAGAGGATGAACTCGAGTTCATCCTCTTCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-626s1c1
Sequence:CCGGCGTGTTAATACAGCTGCCTCACTCGAGTGAGGCAGCTGTATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-1063s1c1
Sequence:CCGGCCGAAGGAGAAATGGCTTCAACTCGAGTTGAAGCCATTTCTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-587s1c1
Sequence:CCGGGCATCCTCTGAGAGAAGAACTCTCGAGAGTTCTTCTCTCAGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-722s1c1
Sequence:CCGGGAAGAGGAAGATGAGGAAGAACTCGAGTTCTTCCTCATCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-731s1c1
Sequence:CCGGGATGAGGAAGAAGATGAGGAACTCGAGTTCCTCATCTTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-665s1c1
Sequence:CCGGGAATCTGAAGAGGGACAAGAACTCGAGTTCTTGTCCCTCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-1064s1c1
Sequence:CCGGCGAAGGAGAAATGGCTTCAAACTCGAGTTTGAAGCCATTTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-905s1c1
Sequence:CCGGGAGTGGGAACAGCAGAATCAACTCGAGTTGATTCTGCTGTTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-614s1c1
Sequence:CCGGCCATCTATTACTCGTGTTAATCTCGAGATTAACACGAGTAATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001872
C14orf37 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 37
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-713s1c1
Sequence:CCGGGAAGATGAAGAAGAGGAAGATCTCGAGATCTTCCTCTTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-695s1c1
Sequence:CCGGGAAGAGGATGAAGAAGATGAACTCGAGTTCATCTTCTTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-600s1c1
Sequence:CCGGGAAGAACTGTTGTTCCATCTACTCGAGTAGATGGAACAACAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-686s1c1
Sequence:CCGGGATGAGGATGAAGAGGATGAACTCGAGTTCATCCTCTTCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-626s1c1
Sequence:CCGGCGTGTTAATACAGCTGCCTCACTCGAGTGAGGCAGCTGTATTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-1063s1c1
Sequence:CCGGCCGAAGGAGAAATGGCTTCAACTCGAGTTGAAGCCATTTCTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-587s1c1
Sequence:CCGGGCATCCTCTGAGAGAAGAACTCTCGAGAGTTCTTCTCTCAGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-722s1c1
Sequence:CCGGGAAGAGGAAGATGAGGAAGAACTCGAGTTCTTCCTCATCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-731s1c1
Sequence:CCGGGATGAGGAAGAAGATGAGGAACTCGAGTTCCTCATCTTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001872.1-665s1c1
Sequence:CCGGGAATCTGAAGAGGGACAAGAACTCGAGTTCTTGTCCCTCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-1064s1c1
Sequence:CCGGCGAAGGAGAAATGGCTTCAAACTCGAGTTTGAAGCCATTTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-905s1c1
Sequence:CCGGGAGTGGGAACAGCAGAATCAACTCGAGTTGATTCTGCTGTTCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001872.1-614s1c1
Sequence:CCGGCCATCTATTACTCGTGTTAATCTCGAGATTAACACGAGTAATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks