EMAIL THIS PAGE TO A FRIEND

C14orf39

chromosome 14 open reading frame 39

37 Gene Product Result for
Synonyms: Six6os1
Gene ID:
chicken(423524) chromosome 5 open reading frame, human C14orf39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059518 Anti-C14orf39 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174978 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000521 MISSION® esiRNA esiRNA targeting human C14orf39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174978 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010071 predicted 418
2 SASI_Hs01_00010072 predicted 297
3 SASI_Hs01_00010073 predicted 547
4 SASI_Hs01_00010074 predicted 1444
5 SASI_Hs01_00010075 predicted 1063
6 SASI_Hs02_00368925 predicted 1109
7 SASI_Hs01_00010077 predicted 1576
8 SASI_Hs01_00010078 predicted 1233
9 SASI_Hs02_00368926 predicted 1232
10 SASI_Hs01_00010079 predicted 1271
11 SASI_Hs01_00010076 predicted 1265
12 SASI_Hs01_00010080 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174978
C14orf39 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 39
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174978.1-2427s1c1
Sequence:CCGGGCTAATGCTTTCAATGGCTAACTCGAGTTAGCCATTGAAAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-374s1c1
Sequence:CCGGGCAGGACCAATTTACTGTTTACTCGAGTAAACAGTAAATTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-1353s1c1
Sequence:CCGGCGAACGTCTGAAATTCCTATACTCGAGTATAGGAATTTCAGACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-1443s1c1
Sequence:CCGGCCGTTCGAAATTAACAGAAATCTCGAGATTTCTGTTAATTTCGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-205s1c1
Sequence:CCGGGCTGTGAAGATATTAAGGAAACTCGAGTTTCCTTAATATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174978
C14orf39 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 39
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174978.1-2427s1c1
Sequence:CCGGGCTAATGCTTTCAATGGCTAACTCGAGTTAGCCATTGAAAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-374s1c1
Sequence:CCGGGCAGGACCAATTTACTGTTTACTCGAGTAAACAGTAAATTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-1353s1c1
Sequence:CCGGCGAACGTCTGAAATTCCTATACTCGAGTATAGGAATTTCAGACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-1443s1c1
Sequence:CCGGCCGTTCGAAATTAACAGAAATCTCGAGATTTCTGTTAATTTCGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-205s1c1
Sequence:CCGGGCTGTGAAGATATTAAGGAAACTCGAGTTTCCTTAATATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174978
C14orf39 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 39
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174978.1-2427s1c1
Sequence:CCGGGCTAATGCTTTCAATGGCTAACTCGAGTTAGCCATTGAAAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-374s1c1
Sequence:CCGGGCAGGACCAATTTACTGTTTACTCGAGTAAACAGTAAATTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-1353s1c1
Sequence:CCGGCGAACGTCTGAAATTCCTATACTCGAGTATAGGAATTTCAGACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-1443s1c1
Sequence:CCGGCCGTTCGAAATTAACAGAAATCTCGAGATTTCTGTTAATTTCGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174978.1-205s1c1
Sequence:CCGGGCTGTGAAGATATTAAGGAAACTCGAGTTTCCTTAATATCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks