EMAIL THIS PAGE TO A FRIEND

C14orf79

chromosome 14 open reading frame 79

93 Gene Product Result for
Species: Human C14orf79(122616)
UniProtKB ID: Q96F83, B2RPK9, Q9BTP4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054771 MISSION® esiRNA esiRNA human C14orf79 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174891 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368760 predicted 649
2 SASI_Hs02_00368761 predicted 1139
3 SASI_Hs02_00368762 predicted 573
4 SASI_Hs02_00368763 predicted 1134
5 SASI_Hs02_00368764 predicted 1106
6 SASI_Hs01_00012740 predicted 997
7 SASI_Hs02_00368765 predicted 702
8 SASI_Hs02_00368766 predicted 1094
9 SASI_Hs02_00368767 predicted 691
10 SASI_Hs02_00368768 predicted 1073
11 SASI_Hs01_00012734 predicted 1288
12 SASI_Hs01_00012735 predicted 1382
13 SASI_Hs01_00012736 predicted 1391
14 SASI_Hs01_00012737 predicted 1389
15 SASI_Hs01_00012738 predicted 928
16 SASI_Hs01_00012739 predicted 735
17 SASI_Hs01_00012741 predicted 1326
18 SASI_Hs01_00012742 predicted 1382
19 SASI_Hs01_00012743 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174891
C14orf79 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 79
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-917s1c1
Sequence:CCGGCCACGCAAGCTCAAATTGACACTCGAGTGTCAATTTGAGCTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-880s1c1
Sequence:CCGGCCAGCACATCACTATTCCAAGCTCGAGCTTGGAATAGTGATGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-934s1c1
Sequence:CCGGGACACTCTTTAATAGCGACGTCTCGAGACGTCGCTATTAAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-925s1c1
Sequence:CCGGGCTCAAATTGACACTCTTTAACTCGAGTTAAAGAGTGTCAATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-936s1c1
Sequence:CCGGCACTCTTTAATAGCGACGTTTCTCGAGAAACGTCGCTATTAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-940s1c1
Sequence:CCGGCTTTAATAGCGACGTTTGCTACTCGAGTAGCAAACGTCGCTATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-921s1c1
Sequence:CCGGGCAAGCTCAAATTGACACTCTCTCGAGAGAGTGTCAATTTGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-965s1c1
Sequence:CCGGCAGGAGGACTTTGTACCTTTACTCGAGTAAAGGTACAAAGTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-915s1c1
Sequence:CCGGCTCCACGCAAGCTCAAATTGACTCGAGTCAATTTGAGCTTGCGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-879s1c1
Sequence:CCGGGCCAGCACATCACTATTCCAACTCGAGTTGGAATAGTGATGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-760s1c1
Sequence:CCGGCTTCTGTCTCCAGCATTGCAACTCGAGTTGCAATGCTGGAGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174891
C14orf79 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 79
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-917s1c1
Sequence:CCGGCCACGCAAGCTCAAATTGACACTCGAGTGTCAATTTGAGCTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-880s1c1
Sequence:CCGGCCAGCACATCACTATTCCAAGCTCGAGCTTGGAATAGTGATGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-934s1c1
Sequence:CCGGGACACTCTTTAATAGCGACGTCTCGAGACGTCGCTATTAAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-925s1c1
Sequence:CCGGGCTCAAATTGACACTCTTTAACTCGAGTTAAAGAGTGTCAATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-936s1c1
Sequence:CCGGCACTCTTTAATAGCGACGTTTCTCGAGAAACGTCGCTATTAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-940s1c1
Sequence:CCGGCTTTAATAGCGACGTTTGCTACTCGAGTAGCAAACGTCGCTATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-921s1c1
Sequence:CCGGGCAAGCTCAAATTGACACTCTCTCGAGAGAGTGTCAATTTGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-965s1c1
Sequence:CCGGCAGGAGGACTTTGTACCTTTACTCGAGTAAAGGTACAAAGTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-915s1c1
Sequence:CCGGCTCCACGCAAGCTCAAATTGACTCGAGTCAATTTGAGCTTGCGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-879s1c1
Sequence:CCGGGCCAGCACATCACTATTCCAACTCGAGTTGGAATAGTGATGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-760s1c1
Sequence:CCGGCTTCTGTCTCCAGCATTGCAACTCGAGTTGCAATGCTGGAGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174891
C14orf79 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 79
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-917s1c1
Sequence:CCGGCCACGCAAGCTCAAATTGACACTCGAGTGTCAATTTGAGCTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-880s1c1
Sequence:CCGGCCAGCACATCACTATTCCAAGCTCGAGCTTGGAATAGTGATGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-934s1c1
Sequence:CCGGGACACTCTTTAATAGCGACGTCTCGAGACGTCGCTATTAAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-925s1c1
Sequence:CCGGGCTCAAATTGACACTCTTTAACTCGAGTTAAAGAGTGTCAATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-936s1c1
Sequence:CCGGCACTCTTTAATAGCGACGTTTCTCGAGAAACGTCGCTATTAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-940s1c1
Sequence:CCGGCTTTAATAGCGACGTTTGCTACTCGAGTAGCAAACGTCGCTATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-921s1c1
Sequence:CCGGGCAAGCTCAAATTGACACTCTCTCGAGAGAGTGTCAATTTGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-965s1c1
Sequence:CCGGCAGGAGGACTTTGTACCTTTACTCGAGTAAAGGTACAAAGTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-915s1c1
Sequence:CCGGCTCCACGCAAGCTCAAATTGACTCGAGTCAATTTGAGCTTGCGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-879s1c1
Sequence:CCGGGCCAGCACATCACTATTCCAACTCGAGTTGGAATAGTGATGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174891.2-760s1c1
Sequence:CCGGCTTCTGTCTCCAGCATTGCAACTCGAGTTGCAATGCTGGAGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks