EMAIL THIS PAGE TO A FRIEND

C14orf80

chromosome 14 open reading frame 80

20 Gene Product Result for
Gene ID:
chicken(424373) chromosome 8 open reading frame, human C14orf80
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001134875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134875 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173608 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027436 predicted 411
2 SASI_Hs01_00027437 predicted 411
3 SASI_Hs01_00027438 predicted 992
4 SASI_Hs01_00027439 predicted 540
5 SASI_Hs01_00027441 predicted 416
6 SASI_Hs01_00027442 predicted 929
7 SASI_Hs01_00027443 predicted 479
8 SASI_Hs01_00027444 predicted 881
9 SASI_Hs01_00027445 predicted 929
10 SASI_Hs02_00368470 predicted 353
11 SASI_Hs01_00027440 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134875
VALIDATED
C14orf80 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 80
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134875.1-1460s21c1
Sequence:CCGGTGGGTCTTGGAGGAGCAGATTCTCGAGAATCTGCTCCTCCAAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134875.1-747s21c1
Sequence:CCGGAGAGCCTTAGCCATCTGTCTGCTCGAGCAGACAGATGGCTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134875.1-414s21c1
Sequence:CCGGTGGCACAACTACCTGAGGATGCTCGAGCATCCTCAGGTAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134875.1-705s21c1
Sequence:CCGGTGAGCAAGATCCACCTGTACACTCGAGTGTACAGGTGGATCTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134875
VALIDATED
C14orf80 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 80
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134875.1-1460s21c1
Sequence:CCGGTGGGTCTTGGAGGAGCAGATTCTCGAGAATCTGCTCCTCCAAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134875.1-747s21c1
Sequence:CCGGAGAGCCTTAGCCATCTGTCTGCTCGAGCAGACAGATGGCTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134875.1-414s21c1
Sequence:CCGGTGGCACAACTACCTGAGGATGCTCGAGCATCCTCAGGTAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134875.1-705s21c1
Sequence:CCGGTGAGCAAGATCCACCTGTACACTCGAGTGTACAGGTGGATCTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134875
VALIDATED
C14orf80 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 80
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134875.1-1460s21c1
Sequence:CCGGTGGGTCTTGGAGGAGCAGATTCTCGAGAATCTGCTCCTCCAAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134875.1-747s21c1
Sequence:CCGGAGAGCCTTAGCCATCTGTCTGCTCGAGCAGACAGATGGCTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134875.1-414s21c1
Sequence:CCGGTGGCACAACTACCTGAGGATGCTCGAGCATCCTCAGGTAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134875.1-705s21c1
Sequence:CCGGTGAGCAAGATCCACCTGTACACTCGAGTGTACAGGTGGATCTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks