EMAIL THIS PAGE TO A FRIEND

C15orf26

chromosome 15 open reading frame 26

53 Gene Product Result for
Species: Human C15orf26(161502)
UniProtKB ID: Q6P656, Q8N906
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173528 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143321 MISSION® esiRNA esiRNA human C15orf26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173528 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368311 predicted 771
2 SASI_Hs02_00368312 predicted 992
3 SASI_Hs01_00113851 predicted 294
4 SASI_Hs02_00368313 predicted 1190
5 SASI_Hs02_00368314 predicted 203
6 SASI_Hs02_00368315 predicted 219
7 SASI_Hs02_00368316 predicted 528
8 SASI_Hs02_00368317 predicted 333
9 SASI_Hs02_00368318 predicted 1203
10 SASI_Hs02_00368319 predicted 1143
11 SASI_Hs01_00113845 predicted 978
12 SASI_Hs01_00113846 predicted 982
13 SASI_Hs01_00113847 predicted 852
14 SASI_Hs01_00113848 predicted 931
15 SASI_Hs01_00113849 predicted 1061
16 SASI_Hs01_00113850 predicted 1113
17 SASI_Hs01_00113852 predicted 1140
18 SASI_Hs01_00113853 predicted 1106
19 SASI_Hs01_00113854 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173528
C15orf26 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 26
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000167929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-715s1c1
Sequence:CCGGCAGGAAGTGTACCTAACAGATCTCGAGATCTGTTAGGTACACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167191    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173528.1-1727s1c1
Sequence:CCGGCCTCTACTTATATCCTTCATTCTCGAGAATGAAGGATATAAGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-350s1c1
Sequence:CCGGCCGTAACTGAAGATGGCTATACTCGAGTATAGCCATCTTCAGTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-744s1c1
Sequence:CCGGCCATGTGAACTGCTGGAATATCTCGAGATATTCCAGCAGTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173528
C15orf26 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 26
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000167929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-715s1c1
Sequence:CCGGCAGGAAGTGTACCTAACAGATCTCGAGATCTGTTAGGTACACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167191    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173528.1-1727s1c1
Sequence:CCGGCCTCTACTTATATCCTTCATTCTCGAGAATGAAGGATATAAGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-350s1c1
Sequence:CCGGCCGTAACTGAAGATGGCTATACTCGAGTATAGCCATCTTCAGTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-744s1c1
Sequence:CCGGCCATGTGAACTGCTGGAATATCTCGAGATATTCCAGCAGTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173528
C15orf26 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 26
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000167929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-715s1c1
Sequence:CCGGCAGGAAGTGTACCTAACAGATCTCGAGATCTGTTAGGTACACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167191    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173528.1-1727s1c1
Sequence:CCGGCCTCTACTTATATCCTTCATTCTCGAGAATGAAGGATATAAGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-350s1c1
Sequence:CCGGCCGTAACTGAAGATGGCTATACTCGAGTATAGCCATCTTCAGTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173528.1-744s1c1
Sequence:CCGGCCATGTGAACTGCTGGAATATCTCGAGATATTCCAGCAGTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks