EMAIL THIS PAGE TO A FRIEND

C15orf27

chromosome 15 open reading frame 27

UniProtKB ID: Q2M3C6, Q8N993, Q96LL5
Gene ID:
chicken(770288) chromosome 10 open reading frame, human C15orf27
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152335 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152335 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365935 predicted 681
2 SASI_Hs02_00365936 predicted 1114
3 SASI_Hs02_00365937 predicted 580
4 SASI_Hs02_00365938 predicted 550
5 SASI_Hs02_00365939 predicted 473
6 SASI_Hs02_00365940 predicted 616
7 SASI_Hs01_00142497 predicted 1593
8 SASI_Hs02_00365941 predicted 228
9 SASI_Hs02_00365942 predicted 354
10 SASI_Hs02_00365943 predicted 499
11 SASI_Hs01_00142491 predicted 1960
12 SASI_Hs01_00142492 predicted 804
13 SASI_Hs01_00142493 predicted 683
14 SASI_Hs01_00142494 predicted 798
15 SASI_Hs01_00142495 predicted 1033
16 SASI_Hs01_00142496 predicted 1811
17 SASI_Hs01_00142498 predicted 1491
18 SASI_Hs01_00142499 predicted 1211
19 SASI_Hs01_00142500 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152335
C15orf27 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 27
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-729s1c1
Sequence:CCGGGAGATGGTTATCCAGCAGTACCTCGAGGTACTGCTGGATAACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-1532s1c1
Sequence:CCGGCTTTCAGATCAGGCCTGTCATCTCGAGATGACAGGCCTGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-1042s1c1
Sequence:CCGGGTCAGTATTACAATGGGCCCACTCGAGTGGGCCCATTGTAATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152335.2-2205s21c1
Sequence:CCGGCCATCTGAGCCTATGTCATTTCTCGAGAAATGACATAGGCTCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-681s21c1
Sequence:CCGGGCTGTGATCATCCTATCTTTGCTCGAGCAAAGATAGGATGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-828s21c1
Sequence:CCGGCTGGAGATGGAGATGGTTATCCTCGAGGATAACCATCTCCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-369s21c1
Sequence:CCGGTACCAAAGAGAAGGGTCTAACCTCGAGGTTAGACCCTTCTCTTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-236s21c1
Sequence:CCGGCCAACAAGTAGACGAAGAAACCTCGAGGTTTCTTCGTCTACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152335
C15orf27 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 27
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-729s1c1
Sequence:CCGGGAGATGGTTATCCAGCAGTACCTCGAGGTACTGCTGGATAACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-1532s1c1
Sequence:CCGGCTTTCAGATCAGGCCTGTCATCTCGAGATGACAGGCCTGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-1042s1c1
Sequence:CCGGGTCAGTATTACAATGGGCCCACTCGAGTGGGCCCATTGTAATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152335.2-2205s21c1
Sequence:CCGGCCATCTGAGCCTATGTCATTTCTCGAGAAATGACATAGGCTCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-681s21c1
Sequence:CCGGGCTGTGATCATCCTATCTTTGCTCGAGCAAAGATAGGATGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-828s21c1
Sequence:CCGGCTGGAGATGGAGATGGTTATCCTCGAGGATAACCATCTCCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-369s21c1
Sequence:CCGGTACCAAAGAGAAGGGTCTAACCTCGAGGTTAGACCCTTCTCTTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-236s21c1
Sequence:CCGGCCAACAAGTAGACGAAGAAACCTCGAGGTTTCTTCGTCTACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152335
C15orf27 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 27
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-729s1c1
Sequence:CCGGGAGATGGTTATCCAGCAGTACCTCGAGGTACTGCTGGATAACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-1532s1c1
Sequence:CCGGCTTTCAGATCAGGCCTGTCATCTCGAGATGACAGGCCTGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152335.1-1042s1c1
Sequence:CCGGGTCAGTATTACAATGGGCCCACTCGAGTGGGCCCATTGTAATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152335.2-2205s21c1
Sequence:CCGGCCATCTGAGCCTATGTCATTTCTCGAGAAATGACATAGGCTCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-681s21c1
Sequence:CCGGGCTGTGATCATCCTATCTTTGCTCGAGCAAAGATAGGATGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-828s21c1
Sequence:CCGGCTGGAGATGGAGATGGTTATCCTCGAGGATAACCATCTCCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-369s21c1
Sequence:CCGGTACCAAAGAGAAGGGTCTAACCTCGAGGTTAGACCCTTCTCTTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152335.2-236s21c1
Sequence:CCGGCCAACAAGTAGACGAAGAAACCTCGAGGTTTCTTCGTCTACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks