EMAIL THIS PAGE TO A FRIEND

C15orf32

chromosome 15 open reading frame 32

54 Gene Product Result for
Species: Human C15orf32(145858)
UniProtKB ID: Q32M92, C5HTZ8, Q96M45
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153040 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366995 predicted 1385
2 SASI_Hs01_00044984 predicted 1097
3 SASI_Hs01_00044985 predicted 1285
4 SASI_Hs01_00044986 predicted 1457
5 SASI_Hs01_00044987 predicted 1055
6 SASI_Hs01_00044988 predicted 1169
7 SASI_Hs01_00044989 predicted 1412
8 SASI_Hs01_00044990 predicted 989
9 SASI_Hs02_00366996 predicted 1420
10 SASI_Hs01_00044993 predicted 1094
11 SASI_Hs01_00044991 predicted 1187
12 SASI_Hs01_00044992 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153040
C15orf32 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 32
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153040.2-1292s21c1
Sequence:CCGGAGATTGGAGCTGTTCGTAATTCTCGAGAATTACGAACAGCTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-928s21c1
Sequence:CCGGGCACCAGAAGAGGCATCTTATCTCGAGATAAGATGCCTCTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-759s21c1
Sequence:CCGGTGCTGAAGCCAACATTGTTAACTCGAGTTAACAATGTTGGCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-797s21c1
Sequence:CCGGAGCCCTGAAGGCCACTTAATTCTCGAGAATTAAGTGGCCTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-854s21c1
Sequence:CCGGCTCGACCCAAAGCAGATATTCCTCGAGGAATATCTGCTTTGGGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153040.1-1027s1c1
Sequence:CCGGGCAACCTTCCTTTGGAGGTTACTCGAGTAACCTCCAAAGGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153040.1-866s1c1
Sequence:CCGGGCAGATATTCTGTGTAGCTGACTCGAGTCAGCTACACAGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153040
C15orf32 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 32
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153040.2-1292s21c1
Sequence:CCGGAGATTGGAGCTGTTCGTAATTCTCGAGAATTACGAACAGCTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-928s21c1
Sequence:CCGGGCACCAGAAGAGGCATCTTATCTCGAGATAAGATGCCTCTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-759s21c1
Sequence:CCGGTGCTGAAGCCAACATTGTTAACTCGAGTTAACAATGTTGGCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-797s21c1
Sequence:CCGGAGCCCTGAAGGCCACTTAATTCTCGAGAATTAAGTGGCCTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-854s21c1
Sequence:CCGGCTCGACCCAAAGCAGATATTCCTCGAGGAATATCTGCTTTGGGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153040.1-1027s1c1
Sequence:CCGGGCAACCTTCCTTTGGAGGTTACTCGAGTAACCTCCAAAGGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153040.1-866s1c1
Sequence:CCGGGCAGATATTCTGTGTAGCTGACTCGAGTCAGCTACACAGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153040
C15orf32 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 32
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153040.2-1292s21c1
Sequence:CCGGAGATTGGAGCTGTTCGTAATTCTCGAGAATTACGAACAGCTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-928s21c1
Sequence:CCGGGCACCAGAAGAGGCATCTTATCTCGAGATAAGATGCCTCTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-759s21c1
Sequence:CCGGTGCTGAAGCCAACATTGTTAACTCGAGTTAACAATGTTGGCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-797s21c1
Sequence:CCGGAGCCCTGAAGGCCACTTAATTCTCGAGAATTAAGTGGCCTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153040.2-854s21c1
Sequence:CCGGCTCGACCCAAAGCAGATATTCCTCGAGGAATATCTGCTTTGGGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153040.1-1027s1c1
Sequence:CCGGGCAACCTTCCTTTGGAGGTTACTCGAGTAACCTCCAAAGGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153040.1-866s1c1
Sequence:CCGGGCAGATATTCTGTGTAGCTGACTCGAGTCAGCTACACAGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks