EMAIL THIS PAGE TO A FRIEND

C15orf37

chromosome 15 open reading frame 37

48 Gene Product Result for
Species: Human C15orf37(283687)
UniProtKB ID: Q8NBB2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302007 ANTI-C15ORF37 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175898 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163937 predicted 875
2 SASI_Hs01_00163936 predicted 768
3 SASI_Hs01_00163939 predicted 398
4 SASI_Hs01_00163940 predicted 27
5 SASI_Hs01_00163941 predicted 11
6 SASI_Hs01_00163942 predicted 87
7 SASI_Hs02_00369163 predicted 156
8 SASI_Hs01_00163943 predicted 1966
9 SASI_Hs02_00369164 predicted 1984
10 SASI_Hs02_00369165 predicted 1480
11 SASI_Hs01_00163938 predicted 696
12 SASI_Hs01_00163944 predicted 1961
13 SASI_Hs01_00163945 predicted 1870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175898
C15orf37 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 37
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-176s1c1
Sequence:CCGGCTACAAGCCCTGTACTTGCAACTCGAGTTGCAAGTACAGGGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-35s1c1
Sequence:CCGGCTATACAAAGCAGAATCCCTGCTCGAGCAGGGATTCTGCTTTGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-30s1c1
Sequence:CCGGGTCTCCTATACAAAGCAGAATCTCGAGATTCTGCTTTGTATAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1388s1c1
Sequence:CCGGGTAGTTTACTTTGTTCAGCAACTCGAGTTGCTGAACAAAGTAAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160359    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1867s1c1
Sequence:CCGGCTAATCACTTTGAAAGGCATTCTCGAGAATGCCTTTCAAAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1474s1c1
Sequence:CCGGGTGTCCTTTAAGAAACCCGAACTCGAGTTCGGGTTTCTTAAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175898
C15orf37 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 37
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-176s1c1
Sequence:CCGGCTACAAGCCCTGTACTTGCAACTCGAGTTGCAAGTACAGGGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-35s1c1
Sequence:CCGGCTATACAAAGCAGAATCCCTGCTCGAGCAGGGATTCTGCTTTGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-30s1c1
Sequence:CCGGGTCTCCTATACAAAGCAGAATCTCGAGATTCTGCTTTGTATAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1388s1c1
Sequence:CCGGGTAGTTTACTTTGTTCAGCAACTCGAGTTGCTGAACAAAGTAAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160359    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1867s1c1
Sequence:CCGGCTAATCACTTTGAAAGGCATTCTCGAGAATGCCTTTCAAAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1474s1c1
Sequence:CCGGGTGTCCTTTAAGAAACCCGAACTCGAGTTCGGGTTTCTTAAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175898
C15orf37 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 37
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-176s1c1
Sequence:CCGGCTACAAGCCCTGTACTTGCAACTCGAGTTGCAAGTACAGGGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-35s1c1
Sequence:CCGGCTATACAAAGCAGAATCCCTGCTCGAGCAGGGATTCTGCTTTGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175898.2-30s1c1
Sequence:CCGGGTCTCCTATACAAAGCAGAATCTCGAGATTCTGCTTTGTATAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1388s1c1
Sequence:CCGGGTAGTTTACTTTGTTCAGCAACTCGAGTTGCTGAACAAAGTAAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160359    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1867s1c1
Sequence:CCGGCTAATCACTTTGAAAGGCATTCTCGAGAATGCCTTTCAAAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175898.2-1474s1c1
Sequence:CCGGGTGTCCTTTAAGAAACCCGAACTCGAGTTCGGGTTTCTTAAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks