EMAIL THIS PAGE TO A FRIEND

C15orf38

chromosome 15 open reading frame 38

40 Gene Product Result for
Species: Human C15orf38(348110)
UniProtKB ID: Q7Z6K5, E2QRD5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182616 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110198 predicted 288
2 SASI_Hs01_00110199 predicted 616
3 SASI_Hs01_00110200 predicted 804
4 SASI_Hs01_00110201 predicted 496
5 SASI_Hs01_00110202 predicted 622
6 SASI_Hs01_00110203 predicted 620
7 SASI_Hs01_00110204 predicted 257
8 SASI_Hs02_00370753 predicted 502
9 SASI_Hs01_00110205 predicted 590
10 SASI_Hs01_00110206 predicted 626
11 SASI_Hs01_00110207 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182616
C15orf38 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 38
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-292s1c1
Sequence:CCGGGTCACATCCATCGCCGTAAATCTCGAGATTTACGGCGATGGATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182616.1-1397s1c1
Sequence:CCGGGCCTGTACTATCCTGCTTCAACTCGAGTTGAAGCAGGATAGTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182616.1-1456s1c1
Sequence:CCGGGCCAGTTCTTTACTCCCTCAACTCGAGTTGAGGGAGTAAAGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182616.1-679s1c1
Sequence:CCGGCAGACAACATCATGGCCCAAACTCGAGTTTGGGCCATGATGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-596s1c1
Sequence:CCGGCCTGGATTCATTGGCCAAACTCTCGAGAGTTTGGCCAATGAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-640s1c1
Sequence:CCGGGTAATTTCACTGGTGATGGAACTCGAGTTCCATCACCAGTGAAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182616.1-635s1c1
Sequence:CCGGCAAGTGTAATTTCACTGGTGACTCGAGTCACCAGTGAAATTACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182616
C15orf38 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 38
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-292s1c1
Sequence:CCGGGTCACATCCATCGCCGTAAATCTCGAGATTTACGGCGATGGATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182616.1-1397s1c1
Sequence:CCGGGCCTGTACTATCCTGCTTCAACTCGAGTTGAAGCAGGATAGTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182616.1-1456s1c1
Sequence:CCGGGCCAGTTCTTTACTCCCTCAACTCGAGTTGAGGGAGTAAAGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182616.1-679s1c1
Sequence:CCGGCAGACAACATCATGGCCCAAACTCGAGTTTGGGCCATGATGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-596s1c1
Sequence:CCGGCCTGGATTCATTGGCCAAACTCTCGAGAGTTTGGCCAATGAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-640s1c1
Sequence:CCGGGTAATTTCACTGGTGATGGAACTCGAGTTCCATCACCAGTGAAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182616.1-635s1c1
Sequence:CCGGCAAGTGTAATTTCACTGGTGACTCGAGTCACCAGTGAAATTACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182616
C15orf38 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 38
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-292s1c1
Sequence:CCGGGTCACATCCATCGCCGTAAATCTCGAGATTTACGGCGATGGATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182616.1-1397s1c1
Sequence:CCGGGCCTGTACTATCCTGCTTCAACTCGAGTTGAAGCAGGATAGTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182616.1-1456s1c1
Sequence:CCGGGCCAGTTCTTTACTCCCTCAACTCGAGTTGAGGGAGTAAAGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182616.1-679s1c1
Sequence:CCGGCAGACAACATCATGGCCCAAACTCGAGTTTGGGCCATGATGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-596s1c1
Sequence:CCGGCCTGGATTCATTGGCCAAACTCTCGAGAGTTTGGCCAATGAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182616.1-640s1c1
Sequence:CCGGGTAATTTCACTGGTGATGGAACTCGAGTTCCATCACCAGTGAAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182616.1-635s1c1
Sequence:CCGGCAAGTGTAATTTCACTGGTGACTCGAGTCACCAGTGAAATTACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks