EMAIL THIS PAGE TO A FRIEND

C15orf39

chromosome 15 open reading frame 39

42 Gene Product Result for
Species: Human C15orf39(56905)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015492 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134501 MISSION® esiRNA esiRNA human C15orf39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015492 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112254 predicted 2750
2 SASI_Hs01_00112255 predicted 3372
3 SASI_Hs01_00112256 predicted 3294
4 SASI_Hs01_00112257 predicted 1691
5 SASI_Hs01_00112258 predicted 297
6 SASI_Hs01_00112259 predicted 1716
7 SASI_Hs01_00112260 predicted 641
8 SASI_Hs01_00112261 predicted 1847
9 SASI_Hs01_00112262 predicted 435
10 SASI_Hs01_00112263 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015492
VALIDATED
C15orf39 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 39
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015492.3-2149s1c1
Sequence:CCGGCATGTTCCGAAAGTTCAAGATCTCGAGATCTTGAACTTTCGGAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-841s1c1
Sequence:CCGGCCTGGAGAAATATCAGACCATCTCGAGATGGTCTGATATTTCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-299s1c1
Sequence:CCGGCACTCTGTTGGTAACCAGGATCTCGAGATCCTGGTTACCAACAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015492.3-3562s1c1
Sequence:CCGGCTAGAGAACACACATGGGCTTCTCGAGAAGCCCATGTGTGTTCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-405s1c1
Sequence:CCGGCATACCCACCCTTGTACTCTACTCGAGTAGAGTACAAGGGTGGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015492.3-2156s1c1
Sequence:CCGGCGAAAGTTCAAGATCCTCCGTCTCGAGACGGAGGATCTTGAACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-2145s1c1
Sequence:CCGGCCTTCATGTTCCGAAAGTTCACTCGAGTGAACTTTCGGAACATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015492.4-2544s21c1
Sequence:CCGGGCGTCCCTGTGTGATGCTATTCTCGAGAATAGCATCACACAGGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-2173s21c1
Sequence:CCGGCCTTCATGTTCCGAAAGTTCACTCGAGTGAACTTTCGGAACATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-3749s21c1
Sequence:CCGGGGGATGCTGCCTGATACATACCTCGAGGTATGTATCAGGCAGCATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-2300s21c1
Sequence:CCGGACTGCGGATTCTCGCTCAACACTCGAGTGTTGAGCGAGAATCCGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015492.4-2908s21c1
Sequence:CCGGCCTCACGCATGCTGAAGTTACCTCGAGGTAACTTCAGCATGCGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015492
VALIDATED
C15orf39 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 39
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015492.3-2149s1c1
Sequence:CCGGCATGTTCCGAAAGTTCAAGATCTCGAGATCTTGAACTTTCGGAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-841s1c1
Sequence:CCGGCCTGGAGAAATATCAGACCATCTCGAGATGGTCTGATATTTCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-299s1c1
Sequence:CCGGCACTCTGTTGGTAACCAGGATCTCGAGATCCTGGTTACCAACAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015492.3-3562s1c1
Sequence:CCGGCTAGAGAACACACATGGGCTTCTCGAGAAGCCCATGTGTGTTCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-405s1c1
Sequence:CCGGCATACCCACCCTTGTACTCTACTCGAGTAGAGTACAAGGGTGGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015492.3-2156s1c1
Sequence:CCGGCGAAAGTTCAAGATCCTCCGTCTCGAGACGGAGGATCTTGAACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-2145s1c1
Sequence:CCGGCCTTCATGTTCCGAAAGTTCACTCGAGTGAACTTTCGGAACATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015492.4-2544s21c1
Sequence:CCGGGCGTCCCTGTGTGATGCTATTCTCGAGAATAGCATCACACAGGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-2173s21c1
Sequence:CCGGCCTTCATGTTCCGAAAGTTCACTCGAGTGAACTTTCGGAACATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-3749s21c1
Sequence:CCGGGGGATGCTGCCTGATACATACCTCGAGGTATGTATCAGGCAGCATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-2300s21c1
Sequence:CCGGACTGCGGATTCTCGCTCAACACTCGAGTGTTGAGCGAGAATCCGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015492.4-2908s21c1
Sequence:CCGGCCTCACGCATGCTGAAGTTACCTCGAGGTAACTTCAGCATGCGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015492
VALIDATED
C15orf39 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 39
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015492.3-2149s1c1
Sequence:CCGGCATGTTCCGAAAGTTCAAGATCTCGAGATCTTGAACTTTCGGAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-841s1c1
Sequence:CCGGCCTGGAGAAATATCAGACCATCTCGAGATGGTCTGATATTTCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-299s1c1
Sequence:CCGGCACTCTGTTGGTAACCAGGATCTCGAGATCCTGGTTACCAACAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015492.3-3562s1c1
Sequence:CCGGCTAGAGAACACACATGGGCTTCTCGAGAAGCCCATGTGTGTTCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-405s1c1
Sequence:CCGGCATACCCACCCTTGTACTCTACTCGAGTAGAGTACAAGGGTGGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015492.3-2156s1c1
Sequence:CCGGCGAAAGTTCAAGATCCTCCGTCTCGAGACGGAGGATCTTGAACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015492.3-2145s1c1
Sequence:CCGGCCTTCATGTTCCGAAAGTTCACTCGAGTGAACTTTCGGAACATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015492.4-2544s21c1
Sequence:CCGGGCGTCCCTGTGTGATGCTATTCTCGAGAATAGCATCACACAGGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-2173s21c1
Sequence:CCGGCCTTCATGTTCCGAAAGTTCACTCGAGTGAACTTTCGGAACATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-3749s21c1
Sequence:CCGGGGGATGCTGCCTGATACATACCTCGAGGTATGTATCAGGCAGCATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015492.4-2300s21c1
Sequence:CCGGACTGCGGATTCTCGCTCAACACTCGAGTGTTGAGCGAGAATCCGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015492.4-2908s21c1
Sequence:CCGGCCTCACGCATGCTGAAGTTACCTCGAGGTAACTTCAGCATGCGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)