EMAIL THIS PAGE TO A FRIEND

C15orf40

chromosome 15 open reading frame 40

Species: Human C15orf40(123207)
UniProtKB ID: Q8WUR7, A6NIC9, B2R5E7, F5GX92, F8WD31, G5EA00
Gene ID:
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144597 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213093 predicted 952
2 SASI_Hs01_00213094 predicted 921
3 SASI_Hs01_00213095 predicted 127
4 SASI_Hs01_00213096 predicted 361
5 SASI_Hs01_00213097 predicted 176
6 SASI_Hs02_00364391 predicted 184
7 SASI_Hs02_00364392 predicted 139
8 SASI_Hs01_00213098 predicted 283
9 SASI_Hs02_00364393 predicted 924
10 SASI_Hs01_00213100 predicted 147
11 SASI_Hs01_00213099 predicted 810
12 SASI_Hs01_00213101 predicted 248
13 SASI_Hs01_00213102 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144597
VALIDATED
C15orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 40
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-316s21c1
Sequence:CCGGATCAGAGGGAGAGGCTAATGCCTCGAGGCATTAGCCTCTCCCTCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-178s21c1
Sequence:CCGGACTTCCTCCCTTAGGTCCTGTCTCGAGACAGGACCTAAGGGAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-210s21c1
Sequence:CCGGCTAAAGGATGCGTCACCATAGCTCGAGCTATGGTGACGCATCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-917s21c1
Sequence:CCGGATATTCGAATAAGACTCCAAACTCGAGTTTGGAGTCTTATTCGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-844s21c1
Sequence:CCGGATGGTGAAGAGGCTGTTAAATCTCGAGATTTAACAGCCTCTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-961s21c1
Sequence:CCGGTACATTGCATCAGGTTCTAAACTCGAGTTTAGAACCTGATGCAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144597.1-228s1c1
Sequence:CCGGGCTGTAACAGATTTGACAGCACTCGAGTGCTGTCAAATCTGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144597.1-414s1c1
Sequence:CCGGCCAGAAGAGATCTTGGAGAAACTCGAGTTTCTCCAAGATCTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144597.1-403s1c1
Sequence:CCGGCTTCTACAACTCCAGAAGAGACTCGAGTCTCTTCTGGAGTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144597.1-1033s1c1
Sequence:CCGGCCTGATTTAACACCTTTCATTCTCGAGAATGAAAGGTGTTAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144597.1-312s1c1
Sequence:CCGGCGGTATCTTTCCAAGGTCCTACTCGAGTAGGACCTTGGAAAGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144597
VALIDATED
C15orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 40
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-316s21c1
Sequence:CCGGATCAGAGGGAGAGGCTAATGCCTCGAGGCATTAGCCTCTCCCTCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-178s21c1
Sequence:CCGGACTTCCTCCCTTAGGTCCTGTCTCGAGACAGGACCTAAGGGAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-210s21c1
Sequence:CCGGCTAAAGGATGCGTCACCATAGCTCGAGCTATGGTGACGCATCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-917s21c1
Sequence:CCGGATATTCGAATAAGACTCCAAACTCGAGTTTGGAGTCTTATTCGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-844s21c1
Sequence:CCGGATGGTGAAGAGGCTGTTAAATCTCGAGATTTAACAGCCTCTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-961s21c1
Sequence:CCGGTACATTGCATCAGGTTCTAAACTCGAGTTTAGAACCTGATGCAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144597.1-228s1c1
Sequence:CCGGGCTGTAACAGATTTGACAGCACTCGAGTGCTGTCAAATCTGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144597.1-414s1c1
Sequence:CCGGCCAGAAGAGATCTTGGAGAAACTCGAGTTTCTCCAAGATCTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144597.1-403s1c1
Sequence:CCGGCTTCTACAACTCCAGAAGAGACTCGAGTCTCTTCTGGAGTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144597.1-1033s1c1
Sequence:CCGGCCTGATTTAACACCTTTCATTCTCGAGAATGAAAGGTGTTAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144597.1-312s1c1
Sequence:CCGGCGGTATCTTTCCAAGGTCCTACTCGAGTAGGACCTTGGAAAGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144597
VALIDATED
C15orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 40
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-316s21c1
Sequence:CCGGATCAGAGGGAGAGGCTAATGCCTCGAGGCATTAGCCTCTCCCTCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-178s21c1
Sequence:CCGGACTTCCTCCCTTAGGTCCTGTCTCGAGACAGGACCTAAGGGAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144597.2-210s21c1
Sequence:CCGGCTAAAGGATGCGTCACCATAGCTCGAGCTATGGTGACGCATCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-917s21c1
Sequence:CCGGATATTCGAATAAGACTCCAAACTCGAGTTTGGAGTCTTATTCGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-844s21c1
Sequence:CCGGATGGTGAAGAGGCTGTTAAATCTCGAGATTTAACAGCCTCTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144597.2-961s21c1
Sequence:CCGGTACATTGCATCAGGTTCTAAACTCGAGTTTAGAACCTGATGCAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144597.1-228s1c1
Sequence:CCGGGCTGTAACAGATTTGACAGCACTCGAGTGCTGTCAAATCTGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144597.1-414s1c1
Sequence:CCGGCCAGAAGAGATCTTGGAGAAACTCGAGTTTCTCCAAGATCTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144597.1-403s1c1
Sequence:CCGGCTTCTACAACTCCAGAAGAGACTCGAGTCTCTTCTGGAGTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144597.1-1033s1c1
Sequence:CCGGCCTGATTTAACACCTTTCATTCTCGAGAATGAAAGGTGTTAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144597.1-312s1c1
Sequence:CCGGCGGTATCTTTCCAAGGTCCTACTCGAGTAGGACCTTGGAAAGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks