EMAIL THIS PAGE TO A FRIEND

C15orf41

chromosome 15 open reading frame 41

124 Gene Product Result for
Synonyms: HH114
Species: Human C15orf41(84529)
UniProtKB ID: Q9Y2V0, B2RD87
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032499 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129751 MISSION® esiRNA esiRNA human C15orf41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032499 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240746 predicted 593
2 SASI_Hs01_00240747 predicted 278
3 SASI_Hs01_00240748 predicted 703
4 SASI_Hs01_00240749 predicted 277
5 SASI_Hs01_00240750 predicted 581
6 SASI_Hs01_00240751 predicted 702
7 SASI_Hs01_00240752 predicted 391
8 SASI_Hs01_00240753 predicted 856
9 SASI_Hs01_00240754 predicted 314
10 SASI_Hs01_00240755 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032499
VALIDATED
C15orf41 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 41
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-787s1c1
Sequence:CCGGCCCACGAACATTGTCACCTTACTCGAGTAAGGTGACAATGTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-407s1c1
Sequence:CCGGGCATTGTGAACGACTGCTGTTCTCGAGAACAGCAGTCGTTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-1923s1c1
Sequence:CCGGGCGAAACATCAGTAAGTTAATCTCGAGATTAACTTACTGATGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032499.3-712s1c1
Sequence:CCGGGTCATCTATTGGTATGGATTTCTCGAGAAATCCATACCAATAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-1167s21c1
Sequence:CCGGTACCGAATCACCCTCTTATTTCTCGAGAAATAAGAGGGTGATTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032499.4-296s21c1
Sequence:CCGGTCCACCCTCCAAGTCTATTATCTCGAGATAATAGACTTGGAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-563s21c1
Sequence:CCGGTGCTGTAGAAGGGCACATAATCTCGAGATTATGTGCCCTTCTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032499.4-688s21c1
Sequence:CCGGTCATCTATTGGTATGGATTTACTCGAGTAAATCCATACCAATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-348s21c1
Sequence:CCGGCCAGATGGAGTTCTAGCAAATCTCGAGATTTGCTAGAACTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-1262s21c1
Sequence:CCGGTGCATTACCATCGTGGAATAACTCGAGTTATTCCACGATGGTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032499
VALIDATED
C15orf41 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 41
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-787s1c1
Sequence:CCGGCCCACGAACATTGTCACCTTACTCGAGTAAGGTGACAATGTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-407s1c1
Sequence:CCGGGCATTGTGAACGACTGCTGTTCTCGAGAACAGCAGTCGTTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-1923s1c1
Sequence:CCGGGCGAAACATCAGTAAGTTAATCTCGAGATTAACTTACTGATGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032499.3-712s1c1
Sequence:CCGGGTCATCTATTGGTATGGATTTCTCGAGAAATCCATACCAATAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-1167s21c1
Sequence:CCGGTACCGAATCACCCTCTTATTTCTCGAGAAATAAGAGGGTGATTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032499.4-296s21c1
Sequence:CCGGTCCACCCTCCAAGTCTATTATCTCGAGATAATAGACTTGGAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-563s21c1
Sequence:CCGGTGCTGTAGAAGGGCACATAATCTCGAGATTATGTGCCCTTCTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032499.4-688s21c1
Sequence:CCGGTCATCTATTGGTATGGATTTACTCGAGTAAATCCATACCAATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-348s21c1
Sequence:CCGGCCAGATGGAGTTCTAGCAAATCTCGAGATTTGCTAGAACTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-1262s21c1
Sequence:CCGGTGCATTACCATCGTGGAATAACTCGAGTTATTCCACGATGGTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032499
VALIDATED
C15orf41 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 41
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-787s1c1
Sequence:CCGGCCCACGAACATTGTCACCTTACTCGAGTAAGGTGACAATGTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-407s1c1
Sequence:CCGGGCATTGTGAACGACTGCTGTTCTCGAGAACAGCAGTCGTTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032499.3-1923s1c1
Sequence:CCGGGCGAAACATCAGTAAGTTAATCTCGAGATTAACTTACTGATGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032499.3-712s1c1
Sequence:CCGGGTCATCTATTGGTATGGATTTCTCGAGAAATCCATACCAATAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-1167s21c1
Sequence:CCGGTACCGAATCACCCTCTTATTTCTCGAGAAATAAGAGGGTGATTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032499.4-296s21c1
Sequence:CCGGTCCACCCTCCAAGTCTATTATCTCGAGATAATAGACTTGGAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-563s21c1
Sequence:CCGGTGCTGTAGAAGGGCACATAATCTCGAGATTATGTGCCCTTCTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032499.4-688s21c1
Sequence:CCGGTCATCTATTGGTATGGATTTACTCGAGTAAATCCATACCAATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-348s21c1
Sequence:CCGGCCAGATGGAGTTCTAGCAAATCTCGAGATTTGCTAGAACTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032499.4-1262s21c1
Sequence:CCGGTGCATTACCATCGTGGAATAACTCGAGTTATTCCACGATGGTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks