EMAIL THIS PAGE TO A FRIEND

C15orf43

chromosome 15 open reading frame 43

43 Gene Product Result for
Species: Human C15orf43(145645)
UniProtKB ID: Q8NHR7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152448 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028341 MISSION® esiRNA esiRNA human C15orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152448 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102225 predicted 522
2 SASI_Hs01_00102226 predicted 597
3 SASI_Hs01_00102228 predicted 606
4 SASI_Hs01_00102229 predicted 607
5 SASI_Hs01_00102230 predicted 495
6 SASI_Hs01_00102231 predicted 535
7 SASI_Hs01_00102232 predicted 492
8 SASI_Hs01_00102233 predicted 501
9 SASI_Hs01_00102234 predicted 358
10 SASI_Hs02_00366214 predicted 205
11 SASI_Hs01_00102227 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152448
C15orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 43
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152448.1-527s21c1
Sequence:CCGGCAACATGGTAACAGGTTATATCTCGAGATATAACCTGTTACCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152448.1-770s21c1
Sequence:CCGGGGATAGTGAAATGGGAAATAACTCGAGTTATTTCCCATTTCACTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152448.1-897s1c1
Sequence:CCGGGCACAGTTGTTAATGAGTAATCTCGAGATTACTCATTAACAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-366s1c1
Sequence:CCGGCATGATGAAGTAACACCAAATCTCGAGATTTGGTGTTACTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-365s1c1
Sequence:CCGGGCATGATGAAGTAACACCAAACTCGAGTTTGGTGTTACTTCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-491s1c1
Sequence:CCGGGCAGATGTACTTCCCTCTACACTCGAGTGTAGAGGGAAGTACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-149s1c1
Sequence:CCGGCCCAGACACGCTGAGAATATACTCGAGTATATTCTCAGCGTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152448
C15orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 43
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152448.1-527s21c1
Sequence:CCGGCAACATGGTAACAGGTTATATCTCGAGATATAACCTGTTACCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152448.1-770s21c1
Sequence:CCGGGGATAGTGAAATGGGAAATAACTCGAGTTATTTCCCATTTCACTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152448.1-897s1c1
Sequence:CCGGGCACAGTTGTTAATGAGTAATCTCGAGATTACTCATTAACAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-366s1c1
Sequence:CCGGCATGATGAAGTAACACCAAATCTCGAGATTTGGTGTTACTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-365s1c1
Sequence:CCGGGCATGATGAAGTAACACCAAACTCGAGTTTGGTGTTACTTCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-491s1c1
Sequence:CCGGGCAGATGTACTTCCCTCTACACTCGAGTGTAGAGGGAAGTACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-149s1c1
Sequence:CCGGCCCAGACACGCTGAGAATATACTCGAGTATATTCTCAGCGTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152448
C15orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 43
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152448.1-527s21c1
Sequence:CCGGCAACATGGTAACAGGTTATATCTCGAGATATAACCTGTTACCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152448.1-770s21c1
Sequence:CCGGGGATAGTGAAATGGGAAATAACTCGAGTTATTTCCCATTTCACTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152448.1-897s1c1
Sequence:CCGGGCACAGTTGTTAATGAGTAATCTCGAGATTACTCATTAACAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-366s1c1
Sequence:CCGGCATGATGAAGTAACACCAAATCTCGAGATTTGGTGTTACTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-365s1c1
Sequence:CCGGGCATGATGAAGTAACACCAAACTCGAGTTTGGTGTTACTTCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-491s1c1
Sequence:CCGGGCAGATGTACTTCCCTCTACACTCGAGTGTAGAGGGAAGTACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152448.1-149s1c1
Sequence:CCGGCCCAGACACGCTGAGAATATACTCGAGTATATTCTCAGCGTGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks