EMAIL THIS PAGE TO A FRIEND

C15orf48

chromosome 15 open reading frame 48

38 Gene Product Result for
Synonyms: FOAP-11 NMES1
Gene ID:
Human(84419) Summary: This gene was first identified in a study of human esophageal squamous cell carcinoma tissues. Levels of both the message and protein are reduced in carcinoma samples. In adult human tissues, this gene is expressed in the the esophagus, stomach, small intestine, colon and placenta. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jun 2012]
chicken(415442) chromosome 10 open reading frame, human C15orf48
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032413 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140751 MISSION® esiRNA esiRNA human C15orf48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032413 Rosetta Predictions human pricing
NM_197955 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238085 predicted 608
2 SASI_Hs01_00238086 predicted 625
3 SASI_Hs01_00238087 predicted 642
4 SASI_Hs01_00238088 predicted 642
5 SASI_Hs01_00238089 predicted 683
6 SASI_Hs01_00238090 predicted 684
7 SASI_Hs01_00238091 predicted 637
8 SASI_Hs01_00238093 predicted 633
9 SASI_Hs02_00359810 predicted 628
10 SASI_Hs01_00238094 predicted 622
11 SASI_Hs01_00238092 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073843 predicted 494
2 SASI_Hs01_00073844 predicted 505
3 SASI_Hs01_00073845 predicted 523
4 SASI_Hs01_00073846 predicted 523
5 SASI_Hs01_00073847 predicted 568
6 SASI_Hs01_00073848 predicted 571
7 SASI_Hs01_00073849 predicted 521
8 SASI_Hs01_00073851 predicted 524
9 SASI_Hs02_00371556 predicted 513
10 SASI_Hs01_00073852 predicted 517
11 SASI_Hs01_00073850 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032413
VALIDATED
C15orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 48
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-271s1c1
Sequence:CCGGCATTCCCTTGGTGGTGTTCATCTCGAGATGAACACCACCAAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032413.2-427s1c1
Sequence:CCGGCAACCAACAATGGAAACCCATCTCGAGATGGGTTTCCATTGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-262s1c1
Sequence:CCGGGAAGGAACTCATTCCCTTGGTCTCGAGACCAAGGGAATGAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032413.2-312s1c1
Sequence:CCGGCCTCATCTTTCGCTGTGTATTCTCGAGAATACACAGCGAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032413.2-571s1c1
Sequence:CCGGCGGAAATGCTTCTGCTACATTCTCGAGAATGTAGCAGAAGCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-415s1c1
Sequence:CCGGGCTTATAACAATCAACCAACACTCGAGTGTTGGTTGATTGTTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-323s1c1
Sequence:CCGGGCTGTGTATTCTCTTTGGAAACTCGAGTTTCCAAAGAGAATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-431s1c1
Sequence:CCGGCAACAATGGAAACCCATTGAACTCGAGTTCAATGGGTTTCCATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-439s1c1
Sequence:CCGGGAAACCCATTGAAGAGTTGCACTCGAGTGCAACTCTTCAATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032413
VALIDATED
C15orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 48
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-271s1c1
Sequence:CCGGCATTCCCTTGGTGGTGTTCATCTCGAGATGAACACCACCAAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032413.2-427s1c1
Sequence:CCGGCAACCAACAATGGAAACCCATCTCGAGATGGGTTTCCATTGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-262s1c1
Sequence:CCGGGAAGGAACTCATTCCCTTGGTCTCGAGACCAAGGGAATGAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032413.2-312s1c1
Sequence:CCGGCCTCATCTTTCGCTGTGTATTCTCGAGAATACACAGCGAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032413.2-571s1c1
Sequence:CCGGCGGAAATGCTTCTGCTACATTCTCGAGAATGTAGCAGAAGCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-415s1c1
Sequence:CCGGGCTTATAACAATCAACCAACACTCGAGTGTTGGTTGATTGTTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-323s1c1
Sequence:CCGGGCTGTGTATTCTCTTTGGAAACTCGAGTTTCCAAAGAGAATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-431s1c1
Sequence:CCGGCAACAATGGAAACCCATTGAACTCGAGTTCAATGGGTTTCCATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-439s1c1
Sequence:CCGGGAAACCCATTGAAGAGTTGCACTCGAGTGCAACTCTTCAATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032413
VALIDATED
C15orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 48
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-271s1c1
Sequence:CCGGCATTCCCTTGGTGGTGTTCATCTCGAGATGAACACCACCAAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032413.2-427s1c1
Sequence:CCGGCAACCAACAATGGAAACCCATCTCGAGATGGGTTTCCATTGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-262s1c1
Sequence:CCGGGAAGGAACTCATTCCCTTGGTCTCGAGACCAAGGGAATGAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032413.2-312s1c1
Sequence:CCGGCCTCATCTTTCGCTGTGTATTCTCGAGAATACACAGCGAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032413.2-571s1c1
Sequence:CCGGCGGAAATGCTTCTGCTACATTCTCGAGAATGTAGCAGAAGCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-415s1c1
Sequence:CCGGGCTTATAACAATCAACCAACACTCGAGTGTTGGTTGATTGTTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-323s1c1
Sequence:CCGGGCTGTGTATTCTCTTTGGAAACTCGAGTTTCCAAAGAGAATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-431s1c1
Sequence:CCGGCAACAATGGAAACCCATTGAACTCGAGTTCAATGGGTTTCCATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032413.2-439s1c1
Sequence:CCGGGAAACCCATTGAAGAGTTGCACTCGAGTGCAACTCTTCAATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks