EMAIL THIS PAGE TO A FRIEND

C15orf52

chromosome 15 open reading frame 52

Species: Human C15orf52(388115)
UniProtKB ID: Q6ZUT6, B9EIQ8, Q68DG9, Q6ZTM3, Q6ZU22
Gene ID:
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207380 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041531 MISSION® esiRNA esiRNA human C15orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207380 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075602 predicted 1791
2 SASI_Hs02_00373983 predicted 426
3 SASI_Hs01_00075603 predicted 1845
4 SASI_Hs01_00075604 predicted 1684
5 SASI_Hs01_00075605 predicted 1926
6 SASI_Hs02_00373984 predicted 332
7 SASI_Hs01_00075606 predicted 1729
8 SASI_Hs02_00373985 predicted 642
9 SASI_Hs02_00373986 predicted 217
10 SASI_Hs01_00075608 predicted 1006
11 SASI_Hs01_00075607 predicted 1322
12 SASI_Hs01_00075609 predicted 1104
13 SASI_Hs01_00075610 predicted 1316
14 SASI_Hs01_00075611 predicted 1314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207380
C15orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 52
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-3779s1c1
Sequence:CCGGGCAGGTAACATTGAGCTCTTTCTCGAGAAAGAGCTCAATGTTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-4283s1c1
Sequence:CCGGCCTGCAAGAAAGACATGTGTTCTCGAGAACACATGTCTTTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-4537s1c1
Sequence:CCGGCGTGCCTAATCTCGTAAGCTACTCGAGTAGCTTACGAGATTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168811    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-1996s1c1
Sequence:CCGGGCTTCCTCTCAGTTCAACAAACTCGAGTTTGTTGAACTGAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-922s21c1
Sequence:CCGGACCATTGCTCCCTGATGGAAACTCGAGTTTCCATCAGGGAGCAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-424s21c1
Sequence:CCGGACCCAGAGTGACCAACGAGATCTCGAGATCTCGTTGGTCACTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-223s21c1
Sequence:CCGGGATAGTTGCCCTGCGCAAGAACTCGAGTTCTTGCGCAGGGCAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-532s21c1
Sequence:CCGCAGAGGGCAAACGGATTGTAAGCTCGAGCTTACAATCCGTTTGCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207380
C15orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 52
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-3779s1c1
Sequence:CCGGGCAGGTAACATTGAGCTCTTTCTCGAGAAAGAGCTCAATGTTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-4283s1c1
Sequence:CCGGCCTGCAAGAAAGACATGTGTTCTCGAGAACACATGTCTTTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-4537s1c1
Sequence:CCGGCGTGCCTAATCTCGTAAGCTACTCGAGTAGCTTACGAGATTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168811    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-1996s1c1
Sequence:CCGGGCTTCCTCTCAGTTCAACAAACTCGAGTTTGTTGAACTGAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-922s21c1
Sequence:CCGGACCATTGCTCCCTGATGGAAACTCGAGTTTCCATCAGGGAGCAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-424s21c1
Sequence:CCGGACCCAGAGTGACCAACGAGATCTCGAGATCTCGTTGGTCACTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-223s21c1
Sequence:CCGGGATAGTTGCCCTGCGCAAGAACTCGAGTTCTTGCGCAGGGCAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-532s21c1
Sequence:CCGCAGAGGGCAAACGGATTGTAAGCTCGAGCTTACAATCCGTTTGCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207380
C15orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 52
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-3779s1c1
Sequence:CCGGGCAGGTAACATTGAGCTCTTTCTCGAGAAAGAGCTCAATGTTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-4283s1c1
Sequence:CCGGCCTGCAAGAAAGACATGTGTTCTCGAGAACACATGTCTTTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-4537s1c1
Sequence:CCGGCGTGCCTAATCTCGTAAGCTACTCGAGTAGCTTACGAGATTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168811    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207380.1-1996s1c1
Sequence:CCGGGCTTCCTCTCAGTTCAACAAACTCGAGTTTGTTGAACTGAGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-922s21c1
Sequence:CCGGACCATTGCTCCCTGATGGAAACTCGAGTTTCCATCAGGGAGCAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-424s21c1
Sequence:CCGGACCCAGAGTGACCAACGAGATCTCGAGATCTCGTTGGTCACTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-223s21c1
Sequence:CCGGGATAGTTGCCCTGCGCAAGAACTCGAGTTCTTGCGCAGGGCAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207380.2-532s21c1
Sequence:CCGCAGAGGGCAAACGGATTGTAAGCTCGAGCTTACAATCCGTTTGCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks