EMAIL THIS PAGE TO A FRIEND

C15orf54

chromosome 15 open reading frame 54

32 Gene Product Result for
Species: Human C15orf54(400360)
UniProtKB ID: Q8N8G6, B7ZVZ9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375191 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018431 MISSION® esiRNA esiRNA targeting human C15orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207445 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111608 predicted 657
2 SASI_Hs01_00111609 predicted 617
3 SASI_Hs01_00111610 predicted 975
4 SASI_Hs01_00111611 predicted 858
5 SASI_Hs01_00111612 predicted 435
6 SASI_Hs02_00374087 predicted 488
7 SASI_Hs01_00111613 predicted 556
8 SASI_Hs01_00111614 predicted 455
9 SASI_Hs01_00111615 predicted 906
10 SASI_Hs01_00111616 predicted 568
11 SASI_Hs01_00111617 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207445
C15orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 54
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-673s1c1
Sequence:CCGGCAGCGGATTGACATTACTCTTCTCGAGAAGAGTAATGTCAATCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-672s1c1
Sequence:CCGGCCAGCGGATTGACATTACTCTCTCGAGAGAGTAATGTCAATCCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-418s1c1
Sequence:CCGGGCTAACTCCATGGCCTAGTTTCTCGAGAAACTAGGCCATGGAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-469s1c1
Sequence:CCGGCTCAAATCTGTTCCTGCACTTCTCGAGAAGTGCAGGAACAGATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1399s1c1
Sequence:CCGGGCCTGATTTATTGGCAGGATACTCGAGTATCCTGCCAATAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207445.1-394s1c1
Sequence:CCGGGCAAAGAATTTGCAGAGCCTTCTCGAGAAGGCTCTGCAAATTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1903s1c1
Sequence:CCGGGCTGAATACTAAGCTCATCAACTCGAGTTGATGAGCTTAGTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1929s1c1
Sequence:CCGGCCTTTGATCTAGGTCTTGATTCTCGAGAATCAAGACCTAGATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207445.1-622s1c1
Sequence:CCGGCCAACTATATGGAGAAGTCATCTCGAGATGACTTCTCCATATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-598s1c1
Sequence:CCGGCCTTTCAAATAAGTTGGAGCACTCGAGTGCTCCAACTTATTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207445
C15orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 54
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-673s1c1
Sequence:CCGGCAGCGGATTGACATTACTCTTCTCGAGAAGAGTAATGTCAATCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-672s1c1
Sequence:CCGGCCAGCGGATTGACATTACTCTCTCGAGAGAGTAATGTCAATCCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-418s1c1
Sequence:CCGGGCTAACTCCATGGCCTAGTTTCTCGAGAAACTAGGCCATGGAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-469s1c1
Sequence:CCGGCTCAAATCTGTTCCTGCACTTCTCGAGAAGTGCAGGAACAGATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1399s1c1
Sequence:CCGGGCCTGATTTATTGGCAGGATACTCGAGTATCCTGCCAATAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207445.1-394s1c1
Sequence:CCGGGCAAAGAATTTGCAGAGCCTTCTCGAGAAGGCTCTGCAAATTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1903s1c1
Sequence:CCGGGCTGAATACTAAGCTCATCAACTCGAGTTGATGAGCTTAGTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1929s1c1
Sequence:CCGGCCTTTGATCTAGGTCTTGATTCTCGAGAATCAAGACCTAGATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207445.1-622s1c1
Sequence:CCGGCCAACTATATGGAGAAGTCATCTCGAGATGACTTCTCCATATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-598s1c1
Sequence:CCGGCCTTTCAAATAAGTTGGAGCACTCGAGTGCTCCAACTTATTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207445
C15orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 54
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-673s1c1
Sequence:CCGGCAGCGGATTGACATTACTCTTCTCGAGAAGAGTAATGTCAATCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-672s1c1
Sequence:CCGGCCAGCGGATTGACATTACTCTCTCGAGAGAGTAATGTCAATCCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-418s1c1
Sequence:CCGGGCTAACTCCATGGCCTAGTTTCTCGAGAAACTAGGCCATGGAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-469s1c1
Sequence:CCGGCTCAAATCTGTTCCTGCACTTCTCGAGAAGTGCAGGAACAGATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1399s1c1
Sequence:CCGGGCCTGATTTATTGGCAGGATACTCGAGTATCCTGCCAATAAATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207445.1-394s1c1
Sequence:CCGGGCAAAGAATTTGCAGAGCCTTCTCGAGAAGGCTCTGCAAATTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1903s1c1
Sequence:CCGGGCTGAATACTAAGCTCATCAACTCGAGTTGATGAGCTTAGTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207445.1-1929s1c1
Sequence:CCGGCCTTTGATCTAGGTCTTGATTCTCGAGAATCAAGACCTAGATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207445.1-622s1c1
Sequence:CCGGCCAACTATATGGAGAAGTCATCTCGAGATGACTTCTCCATATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207445.1-598s1c1
Sequence:CCGGCCTTTCAAATAAGTTGGAGCACTCGAGTGCTCCAACTTATTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375191
C15orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 54
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000121720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375191.1-1435s1c1
Sequence:CCGGCCTGATTTATTGGCAGGATATCTCGAGATATCCTGCCAATAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375191
C15orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 54
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000121720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375191.1-1435s1c1
Sequence:CCGGCCTGATTTATTGGCAGGATATCTCGAGATATCCTGCCAATAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375191
C15orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 54
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000121720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375191.1-1435s1c1
Sequence:CCGGCCTGATTTATTGGCAGGATATCTCGAGATATCCTGCCAATAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks