EMAIL THIS PAGE TO A FRIEND

C15orf56

chromosome 15 open reading frame 56

34 Gene Product Result for
Species: Human C15orf56(644809)
UniProtKB ID: Q8N910
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039905 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205078 predicted 904
2 SASI_Hs01_00205079 predicted 722
3 SASI_Hs02_00308716 predicted 648
4 SASI_Hs01_00205080 predicted 1348
5 SASI_Hs01_00205081 predicted 1366
6 SASI_Hs01_00205082 predicted 1903
7 SASI_Hs01_00205083 predicted 1140
8 SASI_Hs01_00205085 predicted 1943
9 SASI_Hs01_00205086 predicted 2088
10 SASI_Hs01_00205087 predicted 1038
11 SASI_Hs01_00205084 predicted 1956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039905
C15orf56 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 56
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-482s21c1
Sequence:CCGGGAGACCCGACCTGGAGAATCACTCGAGTGATTCTCCAGGTCGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-353s21c1
Sequence:CCGGCCGTGCTGCTCAACTCTTTCTCTCGAGAGAAAGAGTTGAGCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039905.1-1268s21c1
Sequence:CCGGGGTCACTATGGCCACTTATTTCTCGAGAAATAAGTGGCCATAGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-362s21c1
Sequence:CCGGTCAACTCTTTCTCTCCACCTGCTCGAGCAGGTGGAGAGAAAGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039905
C15orf56 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 56
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-482s21c1
Sequence:CCGGGAGACCCGACCTGGAGAATCACTCGAGTGATTCTCCAGGTCGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-353s21c1
Sequence:CCGGCCGTGCTGCTCAACTCTTTCTCTCGAGAGAAAGAGTTGAGCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039905.1-1268s21c1
Sequence:CCGGGGTCACTATGGCCACTTATTTCTCGAGAAATAAGTGGCCATAGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-362s21c1
Sequence:CCGGTCAACTCTTTCTCTCCACCTGCTCGAGCAGGTGGAGAGAAAGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039905
C15orf56 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 56
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-482s21c1
Sequence:CCGGGAGACCCGACCTGGAGAATCACTCGAGTGATTCTCCAGGTCGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-353s21c1
Sequence:CCGGCCGTGCTGCTCAACTCTTTCTCTCGAGAGAAAGAGTTGAGCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039905.1-1268s21c1
Sequence:CCGGGGTCACTATGGCCACTTATTTCTCGAGAAATAAGTGGCCATAGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039905.1-362s21c1
Sequence:CCGGTCAACTCTTTCTCTCCACCTGCTCGAGCAGGTGGAGAGAAAGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks