EMAIL THIS PAGE TO A FRIEND

C15orf57

chromosome 15 open reading frame 57

113 Gene Product Result for
Synonyms: CCDC32
Species: Human C15orf57(90416)
UniProtKB ID: Q9BV29, A8KAL4, Q86TC4, Q8N788, Q8NAR7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052849 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080791 Rosetta Predictions human pricing
NM_001080792 Rosetta Predictions human pricing
NM_052849 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315990 predicted 578
2 SASI_Hs02_00315991 predicted 560
3 SASI_Hs02_00315992 predicted 1162
4 SASI_Hs02_00315993 predicted 1138
5 SASI_Hs02_00315994 predicted 1215
6 SASI_Hs02_00315995 predicted 553
7 SASI_Hs02_00315996 predicted 1282
8 SASI_Hs02_00315997 predicted 1160
9 SASI_Hs02_00315998 predicted 598
10 SASI_Hs02_00315999 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316000 predicted 364
2 SASI_Hs02_00316001 predicted 356
3 SASI_Hs02_00316002 predicted 952
4 SASI_Hs02_00316003 predicted 924
5 SASI_Hs02_00316004 predicted 1004
6 SASI_Hs02_00316005 predicted 344
7 SASI_Hs02_00316006 predicted 1076
8 SASI_Hs02_00316007 predicted 948
9 SASI_Hs02_00316008 predicted 389
10 SASI_Hs02_00316009 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361531 predicted 549
2 SASI_Hs02_00361532 predicted 539
3 SASI_Hs01_00142921 predicted 1139
4 SASI_Hs02_00361533 predicted 1108
5 SASI_Hs01_00142923 predicted 1193
6 SASI_Hs02_00361534 predicted 529
7 SASI_Hs01_00142926 predicted 1258
8 SASI_Hs01_00142927 predicted 1134
9 SASI_Hs02_00361535 predicted 573
10 SASI_Hs02_00361536 predicted 1119
11 SASI_Hs01_00142920 predicted 1155
12 SASI_Hs01_00142922 predicted 381
13 SASI_Hs01_00142924 predicted 301
14 SASI_Hs01_00142925 predicted 321
15 SASI_Hs01_00142928 predicted 307
16 SASI_Hs01_00142929 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052849
C15orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 57
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-322s21c1
Sequence:CCGGAGGATCTCTGGGCTGAAATTTCTCGAGAAATTTCAGCCCAGAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-487s21c1
Sequence:CCGGTGCAGGATTCAGAAGTGTATTCTCGAGAATACACTTCTGAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-671s21c1
Sequence:CCGGTGAGAGCACCTTGGAACATTTCTCGAGAAATGTTCCAAGGTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052849.2-1211s21c1
Sequence:CCGGTAAGTTAAGTGAGCCATATATCTCGAGATATATGGCTCACTTAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052849.2-642s1c1
Sequence:CCGGGAGTTCTTTGTGGATGGACTTCTCGAGAAGTCCATCCACAAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052849.2-498s1c1
Sequence:CCGGGAAGTGTATTTAGCATCTCTACTCGAGTAGAGATGCTAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052849.2-1395s1c1
Sequence:CCGGGCTGGGCTTCTTTCTCTCATTCTCGAGAATGAGAGAAAGAAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052849
C15orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 57
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-322s21c1
Sequence:CCGGAGGATCTCTGGGCTGAAATTTCTCGAGAAATTTCAGCCCAGAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-487s21c1
Sequence:CCGGTGCAGGATTCAGAAGTGTATTCTCGAGAATACACTTCTGAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-671s21c1
Sequence:CCGGTGAGAGCACCTTGGAACATTTCTCGAGAAATGTTCCAAGGTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052849.2-1211s21c1
Sequence:CCGGTAAGTTAAGTGAGCCATATATCTCGAGATATATGGCTCACTTAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052849.2-642s1c1
Sequence:CCGGGAGTTCTTTGTGGATGGACTTCTCGAGAAGTCCATCCACAAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052849.2-498s1c1
Sequence:CCGGGAAGTGTATTTAGCATCTCTACTCGAGTAGAGATGCTAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052849.2-1395s1c1
Sequence:CCGGGCTGGGCTTCTTTCTCTCATTCTCGAGAATGAGAGAAAGAAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052849
C15orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 57
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-322s21c1
Sequence:CCGGAGGATCTCTGGGCTGAAATTTCTCGAGAAATTTCAGCCCAGAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-487s21c1
Sequence:CCGGTGCAGGATTCAGAAGTGTATTCTCGAGAATACACTTCTGAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052849.2-671s21c1
Sequence:CCGGTGAGAGCACCTTGGAACATTTCTCGAGAAATGTTCCAAGGTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052849.2-1211s21c1
Sequence:CCGGTAAGTTAAGTGAGCCATATATCTCGAGATATATGGCTCACTTAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052849.2-642s1c1
Sequence:CCGGGAGTTCTTTGTGGATGGACTTCTCGAGAAGTCCATCCACAAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052849.2-498s1c1
Sequence:CCGGGAAGTGTATTTAGCATCTCTACTCGAGTAGAGATGCTAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052849.2-1395s1c1
Sequence:CCGGGCTGGGCTTCTTTCTCTCATTCTCGAGAATGAGAGAAAGAAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks