EMAIL THIS PAGE TO A FRIEND

C15orf59

chromosome 15 open reading frame 59

17 Gene Product Result for
Species: Human C15orf59(388135)
UniProtKB ID: Q2T9L4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041563 Anti-C15orf59 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039614 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102921 MISSION® esiRNA esiRNA human C15orf59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039614 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064063 predicted 643
2 SASI_Hs01_00064064 predicted 413
3 SASI_Hs01_00064065 predicted 636
4 SASI_Hs02_00308606 predicted 454
5 SASI_Hs01_00064066 predicted 410
6 SASI_Hs01_00064067 predicted 570
7 SASI_Hs01_00064068 predicted 494
8 SASI_Hs01_00064069 predicted 652
9 SASI_Hs01_00064070 predicted 532
10 SASI_Hs01_00064071 predicted 416
11 SASI_Hs01_00064072 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039614
C15orf59 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 59
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-501s21c1
Sequence:CCGGGGTGGTGAGCCAGATCGATAACTCGAGTTATCGATCTGGCTCACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-639s21c1
Sequence:CCGGGGACTTCATGACAGCCGATATCTCGAGATATCGGCTGTCATGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-524s21c1
Sequence:CCGGTAACCTCGGACTTCGACTTTGCTCGAGCAAAGTCGAAGTCCGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-755s21c1
Sequence:CCGGCTGACTACCGCCTCATGAATGCTCGAGCATTCATGAGGCGGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-1190s21c1
Sequence:CCGGACACAGCCACTAGACAGAAAGCTCGAGCTTTCTGTCTAGTGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039614
C15orf59 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 59
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-501s21c1
Sequence:CCGGGGTGGTGAGCCAGATCGATAACTCGAGTTATCGATCTGGCTCACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-639s21c1
Sequence:CCGGGGACTTCATGACAGCCGATATCTCGAGATATCGGCTGTCATGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-524s21c1
Sequence:CCGGTAACCTCGGACTTCGACTTTGCTCGAGCAAAGTCGAAGTCCGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-755s21c1
Sequence:CCGGCTGACTACCGCCTCATGAATGCTCGAGCATTCATGAGGCGGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-1190s21c1
Sequence:CCGGACACAGCCACTAGACAGAAAGCTCGAGCTTTCTGTCTAGTGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039614
C15orf59 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 59
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-501s21c1
Sequence:CCGGGGTGGTGAGCCAGATCGATAACTCGAGTTATCGATCTGGCTCACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-639s21c1
Sequence:CCGGGGACTTCATGACAGCCGATATCTCGAGATATCGGCTGTCATGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-524s21c1
Sequence:CCGGTAACCTCGGACTTCGACTTTGCTCGAGCAAAGTCGAAGTCCGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-755s21c1
Sequence:CCGGCTGACTACCGCCTCATGAATGCTCGAGCATTCATGAGGCGGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039614.1-1190s21c1
Sequence:CCGGACACAGCCACTAGACAGAAAGCTCGAGCTTTCTGTCTAGTGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks