EMAIL THIS PAGE TO A FRIEND

C15orf60

chromosome 15 open reading frame 60

16 Gene Product Result for
Species: Human C15orf60(283677)
UniProtKB ID: Q7Z4M0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042367 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143281 MISSION® esiRNA esiRNA human C15orf60 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042367 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309308 predicted 210
2 SASI_Hs02_00309309 predicted 359
3 SASI_Hs02_00309310 predicted 258
4 SASI_Hs02_00309311 predicted 407
5 SASI_Hs02_00309312 predicted 640
6 SASI_Hs02_00309313 predicted 530
7 SASI_Hs02_00309314 predicted 434
8 SASI_Hs02_00309315 predicted 629
9 SASI_Hs02_00309316 predicted 295
10 SASI_Hs02_00309317 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042367
C15orf60 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 60
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-219s21c1
Sequence:CCGGTTGTTCTCACCATAGTTATATCTCGAGATATAACTATGGTGAGAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-748s21c1
Sequence:CCGGGTGCCTTATGGATCAGAATTTCTCGAGAAATTCTGATCCATAAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-386s21c1
Sequence:CCGGCAGTTCAGTGGAGAGTCAAAGCTCGAGCTTTGACTCTCCACTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-437s21c1
Sequence:CCGGGTTCAGAAGCTGGCACAATACCTCGAGGTATTGTGCCAGCTTCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-341s21c1
Sequence:CCGGTTGTTTGGAACAACGATAAAGCTCGAGCTTTATCGTTGTTCCAAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042367
C15orf60 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 60
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-219s21c1
Sequence:CCGGTTGTTCTCACCATAGTTATATCTCGAGATATAACTATGGTGAGAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-748s21c1
Sequence:CCGGGTGCCTTATGGATCAGAATTTCTCGAGAAATTCTGATCCATAAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-386s21c1
Sequence:CCGGCAGTTCAGTGGAGAGTCAAAGCTCGAGCTTTGACTCTCCACTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-437s21c1
Sequence:CCGGGTTCAGAAGCTGGCACAATACCTCGAGGTATTGTGCCAGCTTCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-341s21c1
Sequence:CCGGTTGTTTGGAACAACGATAAAGCTCGAGCTTTATCGTTGTTCCAAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042367
C15orf60 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 60
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-219s21c1
Sequence:CCGGTTGTTCTCACCATAGTTATATCTCGAGATATAACTATGGTGAGAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-748s21c1
Sequence:CCGGGTGCCTTATGGATCAGAATTTCTCGAGAAATTCTGATCCATAAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-386s21c1
Sequence:CCGGCAGTTCAGTGGAGAGTCAAAGCTCGAGCTTTGACTCTCCACTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-437s21c1
Sequence:CCGGGTTCAGAAGCTGGCACAATACCTCGAGGTATTGTGCCAGCTTCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042367.1-341s21c1
Sequence:CCGGTTGTTTGGAACAACGATAAAGCTCGAGCTTTATCGTTGTTCCAAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)