EMAIL THIS PAGE TO A FRIEND

C15orf61

chromosome 15 open reading frame 61

39 Gene Product Result for
Species: Human C15orf61(145853)
UniProtKB ID: A6NNL5, B4DFB2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062820 Anti-C15orf61 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143936 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226331 MISSION® esiRNA esiRNA targeting human C15orf61 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718659 Rosetta Predictions human pricing
XM_096885 Rosetta Predictions human pricing
XM_940644 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00425476 predicted 536
2 SASI_Hs02_00425477 predicted 532
3 SASI_Hs02_00425478 predicted 515
4 SASI_Hs02_00425479 predicted 357
5 SASI_Hs02_00425480 predicted 379
6 SASI_Hs02_00425481 predicted 536
7 SASI_Hs02_00425482 predicted 525
8 SASI_Hs02_00425483 predicted 548
9 SASI_Hs02_00425484 predicted 355
10 SASI_Hs02_00425485 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_096885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298943 predicted 534
2 SASI_Hs02_00478852 predicted 536
3 SASI_Hs01_00298945 predicted 519
4 SASI_Hs01_00298947 predicted 360
5 SASI_Hs01_00298948 predicted 381
6 SASI_Hs02_00478853 predicted 535
7 SASI_Hs02_00478854 predicted 522
8 SASI_Hs02_00478855 predicted 542
9 SASI_Hs01_00298950 predicted 349
10 SASI_Hs01_00298951 predicted 498
11 SASI_Hs01_00298944 predicted 305
12 SASI_Hs01_00298946 predicted 402
13 SASI_Hs01_00298949 predicted 217
14 SASI_Hs01_00298952 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484349 predicted 527
2 SASI_Hs02_00484350 predicted 530
3 SASI_Hs02_00484351 predicted 519
4 SASI_Hs02_00484352 predicted 362
5 SASI_Hs02_00484353 predicted 378
6 SASI_Hs02_00484354 predicted 538
7 SASI_Hs02_00484355 predicted 527
8 SASI_Hs02_00484356 predicted 541
9 SASI_Hs02_00484357 predicted 358
10 SASI_Hs02_00484358 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143936
VALIDATED
C15orf61 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 61
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-433s21c1
Sequence:CCGGGACTTGGCTCCTGGTTATTTGCTCGAGCAAATAACCAGGAGCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-465s21c1
Sequence:CCGGGAGACTGTGCATACCAGTTATCTCGAGATAACTGGTATGCACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-397s21c1
Sequence:CCGGAGGTCGTCAACCTCGGTATTCCTCGAGGAATACCGAGGTTGACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-534s21c1
Sequence:CCGGTATTGAAAGTGTGCGTCAAAGCTCGAGCTTTGACGCACACTTTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143936.1-996s21c1
Sequence:CCGGATTGTAATCTCAAGTCTAAACCTCGAGGTTTAGACTTGAGATTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143936
VALIDATED
C15orf61 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 61
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-433s21c1
Sequence:CCGGGACTTGGCTCCTGGTTATTTGCTCGAGCAAATAACCAGGAGCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-465s21c1
Sequence:CCGGGAGACTGTGCATACCAGTTATCTCGAGATAACTGGTATGCACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-397s21c1
Sequence:CCGGAGGTCGTCAACCTCGGTATTCCTCGAGGAATACCGAGGTTGACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-534s21c1
Sequence:CCGGTATTGAAAGTGTGCGTCAAAGCTCGAGCTTTGACGCACACTTTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143936.1-996s21c1
Sequence:CCGGATTGTAATCTCAAGTCTAAACCTCGAGGTTTAGACTTGAGATTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143936
VALIDATED
C15orf61 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 61
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-433s21c1
Sequence:CCGGGACTTGGCTCCTGGTTATTTGCTCGAGCAAATAACCAGGAGCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-465s21c1
Sequence:CCGGGAGACTGTGCATACCAGTTATCTCGAGATAACTGGTATGCACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-397s21c1
Sequence:CCGGAGGTCGTCAACCTCGGTATTCCTCGAGGAATACCGAGGTTGACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001143936.1-534s21c1
Sequence:CCGGTATTGAAAGTGTGCGTCAAAGCTCGAGCTTTGACGCACACTTTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143936.1-996s21c1
Sequence:CCGGATTGTAATCTCAAGTCTAAACCTCGAGGTTTAGACTTGAGATTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks