EMAIL THIS PAGE TO A FRIEND

C15orf62

chromosome 15 open reading frame 62

Species: Human C15orf62(643338)
UniProtKB ID: A8K5M9, A6NK01
Gene ID:
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130448 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138151 MISSION® esiRNA esiRNA human C15orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927997 Rosetta Predictions human pricing
XR_041736 Rosetta Predictions human pricing
XR_041737 Rosetta Predictions human pricing
XR_041738 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279478 predicted 518
2 SASI_Hs01_00279479 predicted 985
3 SASI_Hs01_00279480 predicted 1248
4 SASI_Hs01_00279481 predicted 933
5 SASI_Hs01_00279482 predicted 976
6 SASI_Hs01_00279483 predicted 1243
7 SASI_Hs01_00279484 predicted 804
8 SASI_Hs01_00279485 predicted 1353
9 SASI_Hs01_00279486 predicted 1306
10 SASI_Hs01_00279487 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529931 predicted 380
2 SASI_Hs02_00529932 predicted 285
3 SASI_Hs02_00529933 predicted 371
4 SASI_Hs02_00529934 predicted 1265
5 SASI_Hs02_00529935 predicted 1126
6 SASI_Hs02_00529936 predicted 255
7 SASI_Hs02_00529937 predicted 325
8 SASI_Hs02_00529938 predicted 828
9 SASI_Hs02_00529939 predicted 1378
10 SASI_Hs02_00529940 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529941 predicted 371
2 SASI_Hs02_00529942 predicted 281
3 SASI_Hs02_00529943 predicted 364
4 SASI_Hs02_00529944 predicted 1270
5 SASI_Hs02_00529945 predicted 1128
6 SASI_Hs02_00529946 predicted 256
7 SASI_Hs02_00529947 predicted 321
8 SASI_Hs02_00529948 predicted 828
9 SASI_Hs02_00529949 predicted 1378
10 SASI_Hs02_00529950 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529951 predicted 372
2 SASI_Hs02_00529952 predicted 280
3 SASI_Hs02_00529953 predicted 367
4 SASI_Hs02_00529954 predicted 1268
5 SASI_Hs02_00529955 predicted 1123
6 SASI_Hs02_00529956 predicted 250
7 SASI_Hs02_00529957 predicted 329
8 SASI_Hs02_00529958 predicted 832
9 SASI_Hs02_00529959 predicted 1380
10 SASI_Hs02_00529960 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130448
C15orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 62
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-664s21c1
Sequence:CCGGGAAGTCATCCGGGAGCTACAACTCGAGTTGTAGCTCCCGGATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-1025s21c1
Sequence:CCGGCTAGCGAGCCCAGCTTCTAAACTCGAGTTTAGAAGCTGGGCTCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-1003s21c1
Sequence:CCGGCAGATGCTAAGGGAGCAGTTTCTCGAGAAACTGCTCCCTTAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-596s21c1
Sequence:CCGGGGCGACAGAGTAGTGTGCTTACTCGAGTAAGCACACTACTCTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130448.1-1857s21c1
Sequence:CCGGGATAGGTAGAGATAGAGTATACTCGAGTATACTCTATCTCTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130448
C15orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 62
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-664s21c1
Sequence:CCGGGAAGTCATCCGGGAGCTACAACTCGAGTTGTAGCTCCCGGATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-1025s21c1
Sequence:CCGGCTAGCGAGCCCAGCTTCTAAACTCGAGTTTAGAAGCTGGGCTCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-1003s21c1
Sequence:CCGGCAGATGCTAAGGGAGCAGTTTCTCGAGAAACTGCTCCCTTAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-596s21c1
Sequence:CCGGGGCGACAGAGTAGTGTGCTTACTCGAGTAAGCACACTACTCTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130448.1-1857s21c1
Sequence:CCGGGATAGGTAGAGATAGAGTATACTCGAGTATACTCTATCTCTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130448
C15orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 62
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-664s21c1
Sequence:CCGGGAAGTCATCCGGGAGCTACAACTCGAGTTGTAGCTCCCGGATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-1025s21c1
Sequence:CCGGCTAGCGAGCCCAGCTTCTAAACTCGAGTTTAGAAGCTGGGCTCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-1003s21c1
Sequence:CCGGCAGATGCTAAGGGAGCAGTTTCTCGAGAAACTGCTCCCTTAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130448.1-596s21c1
Sequence:CCGGGGCGACAGAGTAGTGTGCTTACTCGAGTAAGCACACTACTCTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130448.1-1857s21c1
Sequence:CCGGGATAGGTAGAGATAGAGTATACTCGAGTATACTCTATCTCTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks