EMAIL THIS PAGE TO A FRIEND

C16orf13

chromosome 16 open reading frame 13

97 Gene Product Result for
Species: Human C16orf13(84326)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040160 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124341 MISSION® esiRNA esiRNA human C16orf13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040160 Rosetta Predictions human pricing
NM_001040161 Rosetta Predictions human pricing
NM_001040162 Rosetta Predictions human pricing
NM_001040163 Rosetta Predictions human pricing
NM_001040164 Rosetta Predictions human pricing
NM_001040165 Rosetta Predictions human pricing
NM_001040166 Rosetta Predictions human pricing
NM_032366 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033050 predicted 270
2 SASI_Hs01_00033051 predicted 357
3 SASI_Hs01_00033052 predicted 445
4 SASI_Hs01_00033053 predicted 350
5 SASI_Hs01_00033054 predicted 274
6 SASI_Hs02_00308868 predicted 530
7 SASI_Hs01_00033055 predicted 358
8 SASI_Hs01_00033056 predicted 301
9 SASI_Hs01_00033057 predicted 508
10 SASI_Hs02_00308869 predicted 353
11 SASI_Hs01_00033049 predicted 355
12 SASI_Hs01_00033058 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308870 predicted 305
2 SASI_Hs02_00308871 predicted 234
3 SASI_Hs01_00085273 predicted 286
4 SASI_Hs01_00085274 predicted 271
5 SASI_Hs01_00085275 predicted 239
6 SASI_Hs01_00085276 predicted 506
7 SASI_Hs01_00085277 predicted 504
8 SASI_Hs01_00085278 predicted 331
9 SASI_Hs01_00085279 predicted 61
10 SASI_Hs01_00085280 predicted 473
11 SASI_Hs01_00085281 predicted 340
12 SASI_Hs01_00085282 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105972 predicted 289
2 SASI_Hs02_00308872 predicted 367
3 SASI_Hs01_00105973 predicted 350
4 SASI_Hs01_00105975 predicted 328
5 SASI_Hs02_00308873 predicted 472
6 SASI_Hs01_00105976 predicted 570
7 SASI_Hs01_00105977 predicted 391
8 SASI_Hs01_00105978 predicted 528
9 SASI_Hs01_00105981 predicted 505
10 SASI_Hs02_00308874 predicted 102
11 SASI_Hs01_00105974 predicted 278
12 SASI_Hs01_00105979 predicted 484
13 SASI_Hs01_00105980 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118596 predicted 475
2 SASI_Hs01_00118597 predicted 469
3 SASI_Hs01_00118598 predicted 461
4 SASI_Hs01_00118599 predicted 467
5 SASI_Hs01_00118600 predicted 522
6 SASI_Hs01_00118601 predicted 456
7 SASI_Hs01_00118602 predicted 512
8 SASI_Hs01_00118603 predicted 570
9 SASI_Hs01_00118604 predicted 723
10 SASI_Hs01_00118605 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196180 predicted 288
2 SASI_Hs01_00196181 predicted 365
3 SASI_Hs01_00196182 predicted 312
4 SASI_Hs01_00196183 predicted 315
5 SASI_Hs01_00196184 predicted 355
6 SASI_Hs01_00196185 predicted 319
7 SASI_Hs01_00196186 predicted 356
8 SASI_Hs01_00196187 predicted 321
9 SASI_Hs01_00196188 predicted 422
10 SASI_Hs01_00196189 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050583 predicted 269
2 SASI_Hs01_00050584 predicted 360
3 SASI_Hs01_00050585 predicted 344
4 SASI_Hs01_00050586 predicted 268
5 SASI_Hs02_00308875 predicted 464
6 SASI_Hs01_00050587 predicted 360
7 SASI_Hs01_00050588 predicted 402
8 SASI_Hs01_00050589 predicted 405
9 SASI_Hs01_00050590 predicted 295
10 SASI_Hs01_00050591 predicted 454
11 SASI_Hs01_00050582 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136220 predicted 641
2 SASI_Hs01_00136221 predicted 371
3 SASI_Hs01_00136222 predicted 351
4 SASI_Hs01_00136223 predicted 543
5 SASI_Hs01_00136224 predicted 367
6 SASI_Hs01_00136225 predicted 584
7 SASI_Hs01_00136226 predicted 518
8 SASI_Hs01_00136227 predicted 628
9 SASI_Hs01_00136228 predicted 305
10 SASI_Hs01_00136229 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114477 predicted 471
2 SASI_Hs01_00114479 predicted 476
3 SASI_Hs01_00114480 predicted 347
4 SASI_Hs01_00114481 predicted 354
5 SASI_Hs01_00114482 predicted 507
6 SASI_Hs02_00359750 predicted 474
7 SASI_Hs01_00114483 predicted 515
8 SASI_Hs01_00114484 predicted 295
9 SASI_Hs01_00114485 predicted 484
10 SASI_Hs02_00359751 predicted 580
11 SASI_Hs01_00114476 predicted 450
12 SASI_Hs01_00114478 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040160
VALIDATED
C16orf13 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-83s21c1
Sequence:CCGGGGAACAAGGATCCCATCTTGCCTCGAGGCAAGATGGGATCCTTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-363s21c1
Sequence:CCGGGGACCTGTTGCTCTGCATCAACTCGAGTTGATGCAGAGCAACAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040160.1-559s21c1
Sequence:CCGGGGACATGCCAGCCAACAACAACTCGAGTTGTTGTTGGCTGGCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040160.1-570s21c1
Sequence:CCGGCCAACAACAAATGCCTGATCTCTCGAGAGATCAGGCATTTGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-374s21c1
Sequence:CCGGTCTGCATCAACATGGCCCATGCTCGAGCATGGGCCATGTTGATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040160
VALIDATED
C16orf13 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-83s21c1
Sequence:CCGGGGAACAAGGATCCCATCTTGCCTCGAGGCAAGATGGGATCCTTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-363s21c1
Sequence:CCGGGGACCTGTTGCTCTGCATCAACTCGAGTTGATGCAGAGCAACAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040160.1-559s21c1
Sequence:CCGGGGACATGCCAGCCAACAACAACTCGAGTTGTTGTTGGCTGGCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040160.1-570s21c1
Sequence:CCGGCCAACAACAAATGCCTGATCTCTCGAGAGATCAGGCATTTGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-374s21c1
Sequence:CCGGTCTGCATCAACATGGCCCATGCTCGAGCATGGGCCATGTTGATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040160
VALIDATED
C16orf13 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-83s21c1
Sequence:CCGGGGAACAAGGATCCCATCTTGCCTCGAGGCAAGATGGGATCCTTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-363s21c1
Sequence:CCGGGGACCTGTTGCTCTGCATCAACTCGAGTTGATGCAGAGCAACAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040160.1-559s21c1
Sequence:CCGGGGACATGCCAGCCAACAACAACTCGAGTTGTTGTTGGCTGGCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040160.1-570s21c1
Sequence:CCGGCCAACAACAAATGCCTGATCTCTCGAGAGATCAGGCATTTGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040160.1-374s21c1
Sequence:CCGGTCTGCATCAACATGGCCCATGCTCGAGCATGGGCCATGTTGATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks