EMAIL THIS PAGE TO A FRIEND

C16orf3

chromosome 16 open reading frame 3

16 Gene Product Result for
Species: Human C16orf3(750)
UniProtKB ID: O95177, O95176, Q52LX9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001214 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182593 predicted 783
2 SASI_Hs02_00331356 predicted 658
3 SASI_Hs01_00182595 predicted 817
4 SASI_Hs02_00331357 predicted 642
5 SASI_Hs02_00331358 predicted 648
6 SASI_Hs02_00331359 predicted 634
7 SASI_Hs01_00182597 predicted 782
8 SASI_Hs02_00331360 predicted 625
9 SASI_Hs02_00331361 predicted 622
10 SASI_Hs02_00331362 predicted 638
11 SASI_Hs01_00182594 predicted 811
12 SASI_Hs01_00182596 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001214
C16orf3 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-658s21c1
Sequence:CCGGACGTGCGATGTGCAGTGCAAGCTCGAGCTTGCACTGCACATCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-633s21c1
Sequence:CCGGAGAAGCCTTCTGAGTCTGTGGCTCGAGCCACAGACTCAGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-649s21c1
Sequence:CCGGTGTGGCTCAACGTGCGATGTGCTCGAGCACATCGCACGTTGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-623s21c1
Sequence:CCGGTGGACCCTGAAGAAGCCTTCTCTCGAGAGAAGGCTTCTTCAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-641s21c1
Sequence:CCGGTCTGAGTCTGTGGCTCAACGTCTCGAGACGTTGAGCCACAGACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001214
C16orf3 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-658s21c1
Sequence:CCGGACGTGCGATGTGCAGTGCAAGCTCGAGCTTGCACTGCACATCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-633s21c1
Sequence:CCGGAGAAGCCTTCTGAGTCTGTGGCTCGAGCCACAGACTCAGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-649s21c1
Sequence:CCGGTGTGGCTCAACGTGCGATGTGCTCGAGCACATCGCACGTTGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-623s21c1
Sequence:CCGGTGGACCCTGAAGAAGCCTTCTCTCGAGAGAAGGCTTCTTCAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-641s21c1
Sequence:CCGGTCTGAGTCTGTGGCTCAACGTCTCGAGACGTTGAGCCACAGACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001214
C16orf3 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-658s21c1
Sequence:CCGGACGTGCGATGTGCAGTGCAAGCTCGAGCTTGCACTGCACATCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-633s21c1
Sequence:CCGGAGAAGCCTTCTGAGTCTGTGGCTCGAGCCACAGACTCAGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-649s21c1
Sequence:CCGGTGTGGCTCAACGTGCGATGTGCTCGAGCACATCGCACGTTGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-623s21c1
Sequence:CCGGTGGACCCTGAAGAAGCCTTCTCTCGAGAGAAGGCTTCTTCAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001214.3-641s21c1
Sequence:CCGGTCTGAGTCTGTGGCTCAACGTCTCGAGACGTTGAGCCACAGACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks