EMAIL THIS PAGE TO A FRIEND

C16orf45

chromosome 16 open reading frame 45

67 Gene Product Result for
UniProtKB ID: Q96MC5, O00223, O75769, Q8IZ36, Q96H25
Gene ID:
chicken(416594) chromosome 14 open reading frame, human C16orf45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033201 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085931 MISSION® esiRNA esiRNA human C16orf45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033201 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130962 predicted 1215
2 SASI_Hs01_00130963 predicted 513
3 SASI_Hs01_00130964 predicted 334
4 SASI_Hs02_00360992 predicted 517
5 SASI_Hs01_00130965 predicted 1152
6 SASI_Hs01_00130966 predicted 508
7 SASI_Hs01_00130967 predicted 565
8 SASI_Hs01_00130969 predicted 1157
9 SASI_Hs01_00130970 predicted 1268
10 SASI_Hs02_00360993 predicted 1267
11 SASI_Hs01_00130961 predicted 1100
12 SASI_Hs01_00130968 predicted 1097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033201
VALIDATED
C16orf45 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 45
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033201.1-598s1c1
Sequence:CCGGCGGTTAAGGGAGCAAGAAGAACTCGAGTTCTTCTTGCTCCCTTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-658s1c1
Sequence:CCGGCCTCTAGACAAAGTAACCAAACTCGAGTTTGGTTACTTTGTCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-1772s1c1
Sequence:CCGGCCCGTGTAATTCATGTACATTCTCGAGAATGTACATGAATTACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033201.1-607s1c1
Sequence:CCGGGAGCAAGAAGAAGACAAGGAACTCGAGTTCCTTGTCTTCTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-531s1c1
Sequence:CCGGGCTAATCCAGAAGATCCACAACTCGAGTTGTGGATCTTCTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-438s1c1
Sequence:CCGGCAAGGACATCATGGACTTGAACTCGAGTTCAAGTCCATGATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033201.1-342s1c1
Sequence:CCGGGATTGAGCTGGAGATGGCAAACTCGAGTTTGCCATCTCCAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033201.1-516s1c1
Sequence:CCGGGCAGAGAGAGGATGAGCTAATCTCGAGATTAGCTCATCCTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-1814s1c1
Sequence:CCGGGCCTGTGTGACTTCTCTGTATCTCGAGATACAGAGAAGTCACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033201
VALIDATED
C16orf45 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 45
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033201.1-598s1c1
Sequence:CCGGCGGTTAAGGGAGCAAGAAGAACTCGAGTTCTTCTTGCTCCCTTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-658s1c1
Sequence:CCGGCCTCTAGACAAAGTAACCAAACTCGAGTTTGGTTACTTTGTCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-1772s1c1
Sequence:CCGGCCCGTGTAATTCATGTACATTCTCGAGAATGTACATGAATTACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033201.1-607s1c1
Sequence:CCGGGAGCAAGAAGAAGACAAGGAACTCGAGTTCCTTGTCTTCTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-531s1c1
Sequence:CCGGGCTAATCCAGAAGATCCACAACTCGAGTTGTGGATCTTCTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-438s1c1
Sequence:CCGGCAAGGACATCATGGACTTGAACTCGAGTTCAAGTCCATGATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033201.1-342s1c1
Sequence:CCGGGATTGAGCTGGAGATGGCAAACTCGAGTTTGCCATCTCCAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033201.1-516s1c1
Sequence:CCGGGCAGAGAGAGGATGAGCTAATCTCGAGATTAGCTCATCCTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-1814s1c1
Sequence:CCGGGCCTGTGTGACTTCTCTGTATCTCGAGATACAGAGAAGTCACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033201
VALIDATED
C16orf45 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 45
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033201.1-598s1c1
Sequence:CCGGCGGTTAAGGGAGCAAGAAGAACTCGAGTTCTTCTTGCTCCCTTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-658s1c1
Sequence:CCGGCCTCTAGACAAAGTAACCAAACTCGAGTTTGGTTACTTTGTCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-1772s1c1
Sequence:CCGGCCCGTGTAATTCATGTACATTCTCGAGAATGTACATGAATTACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033201.1-607s1c1
Sequence:CCGGGAGCAAGAAGAAGACAAGGAACTCGAGTTCCTTGTCTTCTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-531s1c1
Sequence:CCGGGCTAATCCAGAAGATCCACAACTCGAGTTGTGGATCTTCTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-438s1c1
Sequence:CCGGCAAGGACATCATGGACTTGAACTCGAGTTCAAGTCCATGATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033201.1-342s1c1
Sequence:CCGGGATTGAGCTGGAGATGGCAAACTCGAGTTTGCCATCTCCAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033201.1-516s1c1
Sequence:CCGGGCAGAGAGAGGATGAGCTAATCTCGAGATTAGCTCATCCTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_033201.1-1814s1c1
Sequence:CCGGGCCTGTGTGACTTCTCTGTATCTCGAGATACAGAGAAGTCACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks